Previous Contig 010458:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044L16Sequence634001906 (2)gb:AE005172_8917452e-38Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC007508_153589565010458 (2)gb:AP001633_18213777e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P051
JMFF050A13Sequence633001906 (2)gb:AE005172_8917453e-38Arabidopsis thaliana chromosome 1, top arm complete sequence.>gb:AC007508_153589608010458 (2)gb:AC130599_17407294e-29Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0016G07, complet

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF050A13+ TAGCAGAG
                      ____________________________________________________________
consensus TAGCAGAG
 
. : . : . : . : . : . :
rJMFF050A13+ TTCCACAACCAGCTACTTATAACCCAGCTGGACCACATCCAGAAACAACACCCCAATGTC
rJMFF044L16+ CATCCAGAAACAACACCCCAATGTC
                      ____________________________________________________________
consensus TTCCACAACCAGCTACTTATAACCCAGCTGGACCACATCCAGAAACAACACCCCAATGTC
 
. : . : . : . : . : . :
rJMFF050A13+ CTAATAATCTACGCTGATTACTACAACGCCGCCATGACACTTTACCGCTCTCCACAAAAA
rJMFF044L16+ CTAATAATCTACGCTGATTACTACAACGCCGCCATGACACTTTACCGCTCTCCACAAAAA
                      ____________________________________________________________
consensus CTAATAATCTACGCTGATTACTACAACGCCGCCATGACACTTTACCGCTCTCCACAAAAA
 
. : . : . : . : . : . :
rJMFF050A13+ CATGGATTTGTTGGACATTACAAGTGCCTAAGGGCCTGCTGTGGAGGTGGGGGGCCATAC
rJMFF044L16+ CATGGATTTGTTGGACATTACAAGTGCCTAAGGGCCTGCTGTGGAGGTGGGGGGCCATAC
                      ____________________________________________________________
consensus CATGGATTTGTTGGACATTACAAGTGCCTAAGGGCCTGCTGTGGAGGTGGGGGGCCATAC
 
. : . : . : . : . : . :
rJMFF050A13+ AACTACAACTCCTCGGCAGAATGTGGCATACCACCTTCCACTGCGTGTTCTGATCCCTCC
rJMFF044L16+ AACTACAACTCCTCGGCAGAATGTGGCATACCACCTTCCACTGCGTGTTCTGATCCCTCC
                      ____________________________________________________________
consensus AACTACAACTCCTCGGCAGAATGTGGCATACCACCTTCCACTGCGTGTTCTGATCCCTCC
 
. : . : . : . : . : . :
rJMFF050A13+ ACGTACATTGACTGGGACGGCCCTCACTTGACCGAGGCGGCGTATAGATTGATTTCCATT
rJMFF044L16+ ACGTACATTGACTGGGACGGCCCTCACTTGACCGAGGCGGCGTATAGATTGATTTCCATT
                      ____________________________________________________________
consensus ACGTACATTGACTGGGACGGCCCTCACTTGACCGAGGCGGCGTATAGATTGATTTCCATT
 
. : . : . : . : . : . :
rJMFF050A13+ GGCTTGCTTGATGGTCCGTTTACTTCTCCTCAACTTAGGGATGTATGTAGGGCTACTGCA
rJMFF044L16+ GGCTTGCTTGATGGTCCGTTTACTTCTCCTCAACTTAGGGATGTATGTAGGGCTACTGCA
                      ____________________________________________________________
consensus GGCTTGCTTGATGGTCCGTTTACTTCTCCTCAACTTAGGGATGTATGTAGGGCTACTGCA
 
. : . : . : . : . : . :
rJMFF050A13+ ACATTTAAACATCCCCAGGCAATATAGTCCAGTGTATTCACTTCTATTGTACTGCACCGT
rJMFF044L16+ ACATTTAAACATCCCCAGGCAATATAGTCCAGTGTATTCACTTCTATTGTACTGCACCGT
                      ____________________________________________________________
consensus ACATTTAAACATCCCCAGGCAATATAGTCCAGTGTATTCACTTCTATTGTACTGCACCGT
 
. : . : . : . : . : . :
rJMFF050A13+ CTATTAATGTATTGTTTGCGCCAGCGCAAGGTGATGCTCGTTTTGTGATTTTACAGCCAG
rJMFF044L16+ CTATTAATGTATTGTTTGCGCCAGCGCAAGGTGATGCTCGTTTTGTGATTTTACAGCCAG
                      ____________________________________________________________
consensus CTATTAATGTATTGTTTGCGCCAGCGCAAGGTGATGCTCGTTTTGTGATTTTACAGCCAG
 
. : . : . : . : . : . :
rJMFF050A13+ CATAAACCCTAGCTAATAGGTATCATTTATTAAGGAATAACATTAGTTAGCTTTATTCCT
rJMFF044L16+ CATAAACCCTAGCTAATAGGTATCATTTATTAAGGAATAACATTAGTTAGCTTTATTCCT
                      ____________________________________________________________
consensus CATAAACCCTAGCTAATAGGTATCATTTATTAAGGAATAACATTAGTTAGCTTTATTCCT
 
. : . : . : . : . : . :
rJMFF050A13+ TATGTTCCTGTGTATTTTGTTTCAGTCTATGGTTGTTATTTTTCCTTAAGGGGTTGCCAC
rJMFF044L16+ TATGTTCCTGTGTATTTTGTTTCAGTCTATGGTTGTTATTTTTCCTTAAGGGGTTGCCAC
                      ____________________________________________________________
consensus TATGTTCCTGTGTATTTTGTTTCAGTCTATGGTTGTTATTTTTCCTTAAGGGGTTGCCAC