Previous Contig 010457:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044L11Sequence591002106 (4)gb:AC079022_15417162e-09Oryza sativa chromosome 5 clone P0574H01, complete sequence.646010457 (2)
JMFF050A21Sequence591002106 (4)gb:AC079022_15417162e-09Oryza sativa chromosome 5 clone P0574H01, complete sequence.625010457 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF050A21+ AAGCAGAAGAAGTTNNCTGTCATCTGTCTTCCATGGAAGGCGCCGGA
rJMFF044L11+ AGCAGAAGAAGTTTACTGTCATCTGTCTTCCATGGAAGGCGCCGGA
                      ____________________________________________________________
consensus AAGCAGAAGAAGTTTACTGTCATCTGTCTTCCATGGAAGGCGCCGGA
 
. : . : . : . : . : . :
rJMFF050A21+ GCTCGAGTTTATGAGCTAATTGAGCTCAAATCAATAGGGAGATTGCAATGTAAATAACTC
rJMFF044L11+ GCTCGAGTTTATGAGCTAATTGAGCTCAAATCAATAGGGAGATTGCAATGTAAATAACTC
                      ____________________________________________________________
consensus GCTCGAGTTTATGAGCTAATTGAGCTCAAATCAATAGGGAGATTGCAATGTAAATAACTC
 
. : . : . : . : . : . :
rJMFF050A21+ TGGGTATGTAATGATATCTCAATGCTGCATTCAATGGAACAATGGATACTGCTAAAACCA
rJMFF044L11+ TGGGTATGTAATGATATCTCAATGCTGCATTCAATGGAACAATGGATACTGCTAAAACCA
                      ____________________________________________________________
consensus TGGGTATGTAATGATATCTCAATGCTGCATTCAATGGAACAATGGATACTGCTAAAACCA
 
. : . : . : . : . : . :
rJMFF050A21+ TGGCAAAGAAAGAAGCTTTAGCTTAGCTTTAGAAGTGAAGAATCAAGAATGCAGTTGAGA
rJMFF044L11+ TGGCAAAGAAAGAAGCTTTAGCTTAGCTTTAGAAGTGAAGAATCAAGAATGCAGTTGAGA
                      ____________________________________________________________
consensus TGGCAAAGAAAGAAGCTTTAGCTTAGCTTTAGAAGTGAAGAATCAAGAATGCAGTTGAGA
 
. : . : . : . : . : . :
rJMFF050A21+ AGGAAGAACCCAGGGTTAACAATGGCTCCTGGAATCAAGAAGGTACACAGCTCATGTACC
rJMFF044L11+ AGGAAGAACCCAGGGTTAACAATGGCTCCTGGAATCAAGAAGGTACACAGCTCATGTACC
                      ____________________________________________________________
consensus AGGAAGAACCCAGGGTTAACAATGGCTCCTGGAATCAAGAAGGTACACAGCTCATGTACC
 
. : . : . : . : . : . :
rJMFF050A21+ ACAGTGGCTTTGAAATCTAAGAGTTCCTGCTGTTTATTTTTATTTTTACATTATTATACC
rJMFF044L11+ ACAGTGGCTTTGAAATCTAAGAGTTCCTGCTGTTTATTTTTATTTTTACATTATTATACC
                      ____________________________________________________________
consensus ACAGTGGCTTTGAAATCTAAGAGTTCCTGCTGTTTATTTTTATTTTTACATTATTATACC
 
. : . : . : . : . : . :
rJMFF050A21+ TAGGTTCTTTTCATTGGATTTAAGGGCATAGAAACCTTTAAATTGTATTCAGCTTATGGA
rJMFF044L11+ TAGGTTCTTTTCATTGGATTTAAGGGCATAGAAACCTTTAAATTGTATTCAGCTTATGGA
                      ____________________________________________________________
consensus TAGGTTCTTTTCATTGGATTTAAGGGCATAGAAACCTTTAAATTGTATTCAGCTTATGGA
 
. : . : . : . : . : . :
rJMFF050A21+ GTTTACCTGAAATTGGATTTTGGGATTTGATGGTGGATGAATTATTATATTCATGTATAA
rJMFF044L11+ GTTTACCTGAAATTGGATTTTGGGATTTGATGGTGGATGAATTATTATATTCATGTATAA
                      ____________________________________________________________
consensus GTTTACCTGAAATTGGATTTTGGGATTTGATGGTGGATGAATTATTATATTCATGTATAA
 
. : . : . : . : . : . :
rJMFF050A21+ ATGAGTAAATGACATCCCACATTAGAAGGTCATCCTGCTGCTGCTTATAATGGTGGACCT
rJMFF044L11+ ATGAGTAAATGACATCCCACATTAGAAGGTCATCCTGCTGCTGCTTATAATGGTGGACCT
                      ____________________________________________________________
consensus ATGAGTAAATGACATCCCACATTAGAAGGTCATCCTGCTGCTGCTTATAATGGTGGACCT
 
. : . : . : . : . : . :
rJMFF050A21+ TGTGGCTTGAAACATTCTCTTTTATCATGTAATTACATTGTTGTCAGAGGACGATCTTGA
rJMFF044L11+ TGTGGCTTGAAACATTCTCTTTTATCATGTAATTACATTGTTGTCAGAGGACGATCTTGA
                      ____________________________________________________________
consensus TGTGGCTTGAAACATTCTCTTTTATCATGTAATTACATTGTTGTCAGAGGACGATCTTGA
 
. : . : . : . : . : . :
rJMFF050A21+ CAATTGCAATTAATCCTTTCAATAA
rJMFF044L11+ CAATTGCAATTAATCCTTTCAATAAAAAAAAAAGAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus CAATTGCAATTAATCCTTTCAATAAAAAAAAAAGAAAAAAAAAAAAAAACTCTCCAGGGT