Previous Contig 010456:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005C08Sequence227010456 (9)gb:LEA224932_16841801e-26Lycopersicon esculentum H2B-3 mRNA for histone H2B.
JMFF014H15Sequence543010456 (9)pir|D84688|D846882e-43probable histone H2B [imported] - Arabidopsis thaliana>gb:AC007184_1535489 Arabi678010456 (9)pir|D84688|D846883e-43probable histone H2B [imported] - Arabidopsis thaliana>gb:AC007184_1535489 Arabi
JMFF020G08Sequence476010456 (9)pir|D84688|D846888e-37probable histone H2B [imported] - Arabidopsis thaliana>gb:AC007184_1535489 Arabi653010456 (9)pir|D84688|D846883e-43probable histone H2B [imported] - Arabidopsis thaliana>gb:AC007184_1535489 Arabi
JMFF044L05Sequence626010456 (9)pir|D84688|D846883e-43probable histone H2B [imported] - Arabidopsis thaliana>gb:AC007184_1535489 Arabi635010456 (9)pir|D84688|D846883e-43probable histone H2B [imported] - Arabidopsis thaliana>gb:AC007184_1535489 Arabi
JMSF002D24Sequence367010456 (9)pir|D84688|D846882e-16probable histone H2B [imported] - Arabidopsis thaliana>gb:AC007184_1535489 Arabi644010456 (9)pir|D84688|D846883e-43probable histone H2B [imported] - Arabidopsis thaliana>gb:AC007184_1535489 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF002D24- GGGCCAACAACCCATCCGGAATCCCTCTGATTTTCCAGTTTCTCATCTCTCTCTCGATC
JMFF044L05- CAACAACCCATCCGGAATCCCTCTGATTTTCCAGTTTCTCATCTCTCTCTCGATC
rJMFF014H15+ GCCAACAACCCATCCGGAATCCCTCTGATTTTCCAGTTTCTCATCTCTCTCTCGATC
rJMFF020G08+ TGATTTTCCAGTTTCTCATCTCTCTCTCGATC
JMFF014H15- GCCAACAACCCATCCGGAATCCCTCTGATTTTCCAGTTTCTCATCTCTCTCTCGATC
JMFF020G08- GCCAACAACCCATCCGGAATCCCTCTGATTTTCCAGTTTCTCATCTCTCTCTCGATC
rJMSF002D24+ GCCAACAACCCATCCGGAATCCCTCTGATTTTCCAGTTTCTCATCTCTCTCTCGATC
                      ____________________________________________________________
consensus GGGCCAACAACCCATCCGGAATCCCTCTGATTTTCCAGTTTCTCATCTCTCTCTCGATC
 
. : . : . : . : . : . :
JMSF002D24- GATCTAGAAATCTTGTAAGATGGCTCCAAAGGCGGAGAAGAAGACTGCGGAAGAGAAGGC
JMFF044L05- GATCTAGAAATCTTGTAAGATGGCTCCAAAGGCGGAGAAGAAGACTGCGGAAGAGAAGGC
rJMFF014H15+ GATCTAGAAATCTTGTAAGATGGCTCCAAAGGCGGAGAAGAAGACTGCGGAAGAGAAGGC
rJMFF020G08+ GATCTAGAAATCTTGTAAGATGGCTCCAAAGGCGGAGAAGAAGACTGCGGAAGAGAAGGC
JMFF014H15- GATCTAGAAATCTTGTAAGATGGCTCCAAAGGCGGAGAAGAAGACTGCGGAAGAGAAGGC
JMFF020G08- GATCTAGAAATCTTGTAAGATGGCTCCAAAGGCGGAGAAGAAGACTGCGGAAGAGAAGGC
rJMSF002D24+ GATCTAGAAATCTTGTAAGATGGCTCCAAAGGCGGAGAAGAAGACTGCGGAAGAGAAGGC
rJMFF044L05+ CCAAAGGCGGAGAAGAAGACTGCGGAAGAGAAGGC
                      ____________________________________________________________
consensus GATCTAGAAATCTTGTAAGATGGCTCCAAAGGCGGAGAAGAAGACTGCGGAAGAGAAGGC
 
. : . : . : . : . : . :
JMSF002D24- GGCGGCCGTAGGCGACAAGGCGGCGGCGGAGAAGAAGCCTTCCAAGGCCGGGAAGAAGCT
JMFF044L05- GGCGGCCGTAGGCGACAAGGCGGCGGCGGAGAAGAAGCCTTCCAAGGCCGGGAAGAAGCT
rJMFF014H15+ GGCGGCCGTAGGCGACAAGGCGGCGGCGGAGAAGAAGCCTTCCAAGGCCGGGAAGAAGCT
rJMFF020G08+ GGCGGCCGTAGGCGACAAGGCGGCGGCGGAGAAGAAGCCTTCCAAGGCCGGGAAGAAGCT
JMFF014H15- GGCGGCCGTAGGCGACAAGGCGGCGGCGGAGAAGAAGCCTTCCAAGGCCGGGAAGAAGCT
JMFF020G08- GGCGGCCGTAGGCGACAAGGCGGCGGCGGAGAAGAAGCCTTCCAAGGCCGGGAAGAAGCT
rJMSF002D24+ GGCGGCCGTAGGCGACAAGGCGGCGGCGGAGAAGAAGCCTTCCAAGGCCGGGAAGAAGCT
rJMFF044L05+ GGCGGCCGTAGGCGACAAGGCGGCGGCGGAGAAGAAGCCTTCCAAGGCCGGGAAGAAGCT
                      ____________________________________________________________
consensus GGCGGCCGTAGGCGACAAGGCGGCGGCGGAGAAGAAGCCTTCCAAGGCCGGGAAGAAGCT
 
. : . : . : . : . : . :
JMSF002D24- CCCGAAGGAGGCCGGCGGCGCCGCTTCCGGCGAAAAGAAGAGGAAGAAGGCGAAGAAGAG
JMFF044L05- CCCGAAGGAGGCCGGCGGCGCCGCTTCCGGCGAAAAGAAGAGGAAGAAGGCGAAGAAGAG
rJMFF014H15+ CCCGAAGGAGGCCGGCGGCGCCGCTTCCGGCGAAAAGAAGAGGAAGAAGGCGAAGAAGAG
rJMFF020G08+ CCCGAAGGAGGCCGGCGGCGCCGCTTCCGGCGAAAAGAAGAGGAAGAAGGCGAAGAAGAG
JMFF014H15- CCCGAAGGAGGCCGGCGGCGCCGCTTCCGGCGAAAAGAAGAGGAAGAAGGCGAAGAAGAG
JMFF020G08- CCCGAAGGAGGCCGGCGGCGCCGCTTCCGGCGAAAAGAAGAGGAAGAAGGCGAAGAAGAG
rJMSF002D24+ CCCGAAGGAGGCCGGCGGCGCCGCTTCCGGCGAAAAGAAGAGGAAGAAGGCGAAGAAGAG
rJMFF044L05+ CCCGAAGGAGGCCGGCGGCGCCGCTTCCGGCGAAAAGAAGAGGAAGAAGGCGAAGAAGAG
                      ____________________________________________________________
consensus CCCGAAGGAGGCCGGCGGCGCCGCTTCCGGCGAAAAGAAGAGGAAGAAGGCGAAGAAGAG
 
. : . : . : . : . : . :
JMSF002D24- CACCGAGACTTACAAGATCTATATCTTCAAGGTCCTGAAACAGGTCCACCCTGACATCGG
JMFF044L05- CACCGAGACTTACAAGATCTATATCTTCAAGGTCCTGAAACAGGTCCACCCTGACATCGG
rJMFF014H15+ CACCGAGACTTACAAGATCTATATCTTCAAGGTCCTGAAACAGGTCCACCCTGACATCGG
rJMFF020G08+ CACCGAGACTTACAAGATCTATATCTTCAAGGTCCTGAAACAGGTCCACCCTGACATCGG
rJMFF005C08+ ACCCTGACATCGG
JMFF014H15- CACCGAGACTTACAAGATCTATATCTTCAAGGTCCTGAAACAGGTCCACCCTGACATCGG
JMFF020G08- CACCGAGACTTACAAGATCTATATCTTCAAGGTCCTGAAACAGGTCCACCCTGACATCGG
rJMSF002D24+ CACCGAGACTTACAAGATCTATATCTTCAAGGTCCTGAAACAGGTCCACCCTGACATCGG
rJMFF044L05+ CACCGAGACTTACAAGATCTATATCTTCAAGGTCCTGAAACAGGTCCACCCTGACATCGG
                      ____________________________________________________________
consensus CACCGAGACTTACAAGATCTATATCTTCAAGGTCCTGAAACAGGTCCACCCTGACATCGG
 
. : . : . : . : . : . :
JMSF002D24- GATCTCCAGCAAGGCCATGGGGATCATGAACAGCTTCATCAATGATATCTTCGAGAAGCT
JMFF044L05- GATCTCCAGCAAGGCCATGGGGATCATGAACAGCTTCATCAATGATATCTTCGAGAAGCT
rJMFF014H15+ GATCTCCAGCAAGGCCATGGGGATCATGAACAGCTTCATCAATGATATCTTCGAGAAGCT
rJMFF020G08+ GATCTCCAGCAAGGCCATGGGGATCATGAACAGCTTCATCAATGATATCTTCGAGAAGCT
rJMFF005C08+ GATCTCCAGCAAGGCCATGGGGATCANGAACAGNTTCATCAATGATATNTTCGAGAAGCN
JMFF014H15- GATCTCCAGCAAGGCCATGGGGATCATGAACAGCTTCATCAATGATATCTTCGAGAAGCT
JMFF020G08- GATCTCCAGCAAGGCCATGGGGATCATGAACAGCTTCATCAATGATATCTTCGAGAAGCT
rJMSF002D24+ GATCTCCAGCAAGGCCATGGGGATCATGAACAGCTTCATCAATGATATCTTCGAGAAGCT
rJMFF044L05+ GATCTCCAGCAAGGCCATGGGGATCATGAACAGCTTCATCAATGATATCTTCGAGAAGCT
                      ____________________________________________________________
consensus GATCTCCAGCAAGGCCATGGGGATCATGAACAGCTTCATCAATGATATCTTCGAGAAGCT
 
. : . : . : . : . : . :
JMSF002D24- GGCGCAGG
JMFF044L05- GGCGCAGGAGGCTTCGAGGCTCGCGCGCTACAACAAGAAGCCGACGATCACCTCCCGGGA
rJMFF014H15+ GGCGCAGGAGGCTTCGAGGCTCGCGCGCTACAACAAGAAGCCGACGATCACCTCCCGGGA
rJMFF020G08+ GGCGCAGGAGGCTTCGAGGCTCGCGCGCTACAACAAGAAGCCGACGATCACCTCCCGGGA
rJMFF005C08+ GGCGCAGGAGGCTTNGAGGCTCGCGCGCTACAACAAGAAGCCGACGATCACCTCCCGGGA
JMFF014H15- GGCGCAGGAGGCTTCGAGGCTCGCGCGCTACAACAAGAAGCCGACGATCACCTCCCGGGA
JMFF020G08- GGCGCAGGAGGCTTCGAGGCTCGCGCGCTACAACAAGAAGCCGACGATCACCTCCCGGGA
rJMSF002D24+ GGCGCAGGAGGCTTCGAGGCTCGCGCGCTACAACAAGAAGCCGACGATCACCTCCCGGGA
rJMFF044L05+ GGCGCAGGAGGCTTCGAGGCTCGCGCGCTACAACAAGAAGCCGACGATCACCTCCCGGGA
                      ____________________________________________________________
consensus GGCGCAGGAGGCTTCGAGGCTCGCGCGCTACAACAAGAAGCCGACGATCACCTCCCGGGA
 
. : . : . : . : . : . :
JMFF044L05- GATCCAGACGGCGGTGCGGCTTGTGCTTCCCGGTGAACTGGCTAAGCACGCCGTCTCTGA
rJMFF014H15+ GATCCAGACGGCGGTGCGGCTTGTGCTTCCCGGTGAACTGGCTAAGCACGCCGTCTCTGA
rJMFF020G08+ GATCCAGACGGCGGTGCGGCTTGTGCTTCCCGGTGAACTGGCTAAGCACGCCGTCTCTGA
rJMFF005C08+ GATCCAGACGNCGGTGCGGCTTGTGCTTCCCNGTGAACTGGNTAAGCACNCCGTCTCTGA
JMFF014H15- GATCCAGACGGCGGTGCGGCTTGTGCTTCCCGGTGAACTGGCTAAGCACGCCGTCTCTGA
JMFF020G08- GATCCAGACGGCGGTGCGGCTTGTGCTTCCCGGTGAACTGGCTAAGCACGCCGTCTCTG
rJMSF002D24+ GATCCAGACGGCGGTGCGGCTTGTGCTTCCCGGTGAACTGGCTAAGCACGCCGTCTCTGA
rJMFF044L05+ GATCCAGACGGCGGTGCGGCTTGTGCTTCCCGGTGAACTGGCTAAGCACGCCGTCTCTGA
                      ____________________________________________________________
consensus GATCCAGACGGCGGTGCGGCTTGTGCTTCCCGGTGAACTGGCTAAGCACGCCGTCTCTGA
 
. : . : . : . : . : . :
JMFF044L05- GGGGACTAAGGCGGTGACTAAGTTTACGAGCTCTTGAAGGTTTGATTGGTCTCTTTTTTG
rJMFF014H15+ GGGGACTAAGGCGGTGACTAAGTTTACGAGCTCTTGAA
rJMFF020G08+ GGGGACTAAGGCGGTGACTAAGTTTACGAGCTCTTGAA
rJMFF005C08+ GGNGACTAAGGCGGNGATTAAGTTTNCGAGCTCT
JMFF014H15- GGGGACTAAGGCGGTGACTAAGTTTACGAGCTCTTGAAGGTTTGATTGGTCTCTTTTTTG
rJMSF002D24+ GGGGACTAAGGCGGTGACTAAGTTTACGAGCTCTTGAAGGTTTGATTGGTCTCTTTTTTG
rJMFF044L05+ GGGGACTAAGGCGGTGACTAAGTTTACGAGCTCTTGAAGGTTTGATTGGTCTCTTTTTTG
                      ____________________________________________________________
consensus GGGGACTAAGGCGGTGACTAAGTTTACGAGCTCTTGAAGGTTTGATTGGTCTCTTTTTTG
 
. : . : . : . : . : . :
JMFF044L05- GATGTAGAATTTTAGGGATGTGATAAANCACAGTAATTTCAGTCGTAATTTGTCTTTTGG
JMFF014H15- GATGTA
rJMSF002D24+ GATGTAGAATTTTAGGGATGTGATAAACAACAGTAATTTCAGTCGTAATTTGTCTTTTGG
rJMFF044L05+ GATGTAGAATTTTAGGGATGTGATAAACAACAGTAATTTCAGTCGTAATTTGTCTTTTGG
                      ____________________________________________________________
consensus GATGTAGAATTTTAGGGATGTGATAAACAACAGTAATTTCAGTCGTAATTTGTCTTTTGG
 
. : . : . : . : . : . :
JMFF044L05- GGTTTAGATTATAGAATCAGTTGTTGGATTT
rJMSF002D24+ GGTTTAGATTATAGAATCAGTTGTTGGATTTGTGTCTCTTCTCTT
rJMFF044L05+ GGTTTAGATTATAGAATCAGTTGTTGGATTTGTGTCTCTTCTCTTTTGTTGCACATGTAC
                      ____________________________________________________________
consensus GGTTTAGATTATAGAATCAGTTGTTGGATTTGTGTCTCTTCTCTTTTGTTGCACATGTAC
 
. : . : . : . : . : . :
rJMFF044L05+ AATCCGAAGCATTAATGGCAAATCTTTCATTGCAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus AATCCGAAGCATTAATGGCAAATCTTTCATTGCAAAAAAAAAAAAAAAACTCTCCAGGGT