Previous Contig 010452:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044K16Sequence643010452 (2)gb:AY648332_16200109e-45Arabidopsis thaliana hypothetical protein (At3g03773) mRNA, complete cds.>gb:BT0576010452 (2)gb:AY648332_16200102e-33Arabidopsis thaliana hypothetical protein (At3g03773) mRNA, complete cds.>gb:BT0

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044K16- GGCCCCCAGTCACTTCACCTCTCT
                      ____________________________________________________________
consensus GGCCCCCAGTCACTTCACCTCTCT
 
. : . : . : . : . : . :
JMFF044K16- CCCGGTTCACATCCCTAGCTTCCTCGTCTCTTCACTTCGGACTTCTGCTTAACAAGTACG
                      ____________________________________________________________
consensus CCCGGTTCACATCCCTAGCTTCCTCGTCTCTTCACTTCGGACTTCTGCTTAACAAGTACG
 
. : . : . : . : . : . :
JMFF044K16- CTCGCCGGAGATTTCTGATACAACCAGTACAACCTTCTTCTGCTAATTAGCCTTTGCGAA
                      ____________________________________________________________
consensus CTCGCCGGAGATTTCTGATACAACCAGTACAACCTTCTTCTGCTAATTAGCCTTTGCGAA
 
. : . : . : . : . : . :
JMFF044K16- AATGGAAACTGGAAAAAATTGCAGCCGGCAGCCGGAGGTGCTGTGGGCTCAGCGATCCGA
                      ____________________________________________________________
consensus AATGGAAACTGGAAAAAATTGCAGCCGGCAGCCGGAGGTGCTGTGGGCTCAGCGATCCGA
 
. : . : . : . : . : . :
JMFF044K16- CAAGGTCTACTTGACCGTCTCTCTTCCGGATGCCAAAGACATCTCCGTCACGCCGGAGGC
rJMFF044K16+ TCCGGATGCCAAAGACATCTCCGTCACGCCGGAGGC
                      ____________________________________________________________
consensus CAAGGTCTACTTGACCGTCTCTCTTCCGGATGCCAAAGACATCTCCGTCACGCCGGAGGC
 
. : . : . : . : . : . :
JMFF044K16- GGCAGGACTCTTCGCTTTCTCCGCGGTCGGCGCACAGGGAGAACCCTTCTCCTTCTCTCT
rJMFF044K16+ GGCAGGACTCTTCGCTTTCTCCGCGGTCGGCGCACAGGGAGAACCCTTCTCCTTCTCTCT
                      ____________________________________________________________
consensus GGCAGGACTCTTCGCTTTCTCCGCGGTCGGCGCACAGGGAGAACCCTTCTCCTTCTCTCT
 
. : . : . : . : . : . :
JMFF044K16- CCAGCTCTACGGCAATATTGCCCCCCAGGCTTGTAAAACCAATATTGGTTTGAGGAACAT
rJMFF044K16+ CCAGCTTTACGGCAATATTGCCCCCCAGGCTTGTAAAACCAATATTGGTTTGAGGAACAT
                      ____________________________________________________________
consensus CCAGCTTTACGGCAATATTGCCCCCCAGGCTTGTAAAACCAATATTGGTTTGAGGAACAT
 
. : . : . : . : . : . :
JMFF044K16- TCTATGCTCAGTTCAGAAGGAGCAAAAGTCTTGGTGGCCAAGATTATTGAAGTCGGAAGA
rJMFF044K16+ TCTATGCTCAGTTCAGAAGGAGCAAAAGTCTTGGTGGCCAAGATTATTGAAGTCGGAAGA
                      ____________________________________________________________
consensus TCTATGCTCAGTTCAGAAGGAGCAAAAGTCTTGGTGGCCAAGATTATTGAAGTCGGAAGA
 
. : . : . : . : . : . :
JMFF044K16- AAAGCCTGCTCCATACATTAAGGTTGATTGGAACAAGTGGTGTGATGAAGACGATGAAGA
rJMFF044K16+ AAAGCCTGCTCCATACATTAAGGTTGATTGGAACAAGTGGTGTGATGAAGACGATGAAGA
                      ____________________________________________________________
consensus AAAGCCTGCTCCATACATTAAGGTTGATTGGAACAAGTGGTGTGATGAAGACGATGAAGA
 
. : . : . : . : . : . :
JMFF044K16- TTCTTCTGATGTGGCCCTTGATGATGATTTTGCGTATGCTGGCGGTGAAGATGATGAGAG
rJMFF044K16+ TTCTTCTGATGTGGCCCTTGATGATGATTTTGCGTATGCTGGCGGTGAAGATGATGAGAG
                      ____________________________________________________________
consensus TTCTTCTGATGTGGCCCTTGATGATGATTTTGCGTATGCTGGCGGTGAAGATGATGAGAG
 
. : . : . : . : . : . :
JMFF044K16- CAGTGATGATGGAGGAATGCTTTATCTTCCTGACCTGGAGAAAGCTAGAGGAAATTAACA
rJMFF044K16+ CAGTGATGATGGAGGAATGCTTTATCTTCCTGACCTGGAGAAAGCTAGAGGAAATTAACA
                      ____________________________________________________________
consensus CAGTGATGATGGAGGAATGCTTTATCTTCCTGACCTGGAGAAAGCTAGAGGAAATTAACA
 
. : . : . : . : . : . :
JMFF044K16- CNATACTATGAATCTTCCA
rJMFF044K16+ CAATACTATGAATCTTCCAGAAGCACAAGCAGCCACGTCCTAGAGGCTGCTTTTAACAAC
                      ____________________________________________________________
consensus CAATACTATGAATCTTCCAGAAGCACAAGCAGCCACGTCCTAGAGGCTGCTTTTAACAAC
 
. : . : . : . : . : . :
rJMFF044K16+ TTGGCTTGTGTAACAAATTACCAAGACAGTCTTACTGAAACATGTAGATGTTGCTCGTTT
                      ____________________________________________________________
consensus TTGGCTTGTGTAACAAATTACCAAGACAGTCTTACTGAAACATGTAGATGTTGCTCGTTT
 
. : . : . : . : . : . :
rJMFF044K16+ TCGAGGATTATTAACTGGCTATATTTCAGACATAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TCGAGGATTATTAACTGGCTATATTTCAGACATAAAAAAAAAAAAAAAACTCTCCAGGGT