Previous Contig 010450:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015K16Sequence573010450 (6)gb:AY049243_15618852e-82Arabidopsis thaliana AT5g18170/MRG7_13 mRNA, complete cds.550010450 (6)gb:NTA420266_16914051e-71Nicotiana tabacum mRNA for glutamate dehydrogenase (gdh1 gene).
JMFF044K08Sequence636010450 (6)gb:AJ879895_18151377e-87Glycine max mRNA for glutamate dehydrogenase 1 (gdh1 gene).546010450 (6)gb:NTA420266_16914053e-56Nicotiana tabacum mRNA for glutamate dehydrogenase (gdh1 gene).
JMSF046J06Sequence786010450 (6)gb:AJ879895_1815137e-137Glycine max mRNA for glutamate dehydrogenase 1 (gdh1 gene).828010450 (6)sp|Q9LEC8|DHEB_NICPLe-114Glutamate dehydrogenase B (EC 1.4.1.3) (GDH B).>gb:NPL277950_1691081 Nicotiana p

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044K08- GAGTGTTGTGGCACCTTGCTGGAAACTTTATCTAAACTTTGATT
                      ____________________________________________________________
consensus GAGTGTTGTGGCACCTTGCTGGAAACTTTATCTAAACTTTGATT
 
. : . : . : . : . : . :
JMFF044K08- TTCTGGGCTATAAATATGGATAGAGACAGCTGCTTACCAGGGCATCTGATTTTCATCTTC
                      ____________________________________________________________
consensus TTCTGGGCTATAAATATGGATAGAGACAGCTGCTTACCAGGGCATCTGATTTTCATCTTC
 
. : . : . : . : . : . :
JMFF015K16- CATGAATGCTTTAGCTGCTA
JMFF044K08- TTCCTCCATCTGCTTCTGTGTTGACTTCTTGTTTCAGGATCATGAATGCCTTGGCTGCTA
JMSF046J06- CATGAATGCCTTGGCTGCTA
                      ____________________________________________________________
consensus TTCCTCCATCTGCTTCTGTGTTGACTTCTTGTTTCAGGATCATGAATGCCTTGGCTGCTA
 
. : . : . : . : . : . :
JMFF015K16- CCAACAGAAACTTTAGGCTGGCAGCTCGGCTCCTAGGCTTGGATTCAAAACTCGAGAGGA
JMFF044K08- CCAACCGGAACTTCAAGCTGGCGGCACGGCTGCTGGGTTTGGATTCGAAGCTCGAGAACA
JMSF046J06- CCAACCGGAACTTCAAGCTGGCGGCACGGCTGCTGGGTTTGGATTCGAAGCTCGAGAACA
                      ____________________________________________________________
consensus CCAACCGGAACTTCAAGCTGGCGGCACGGCTGCTGGGTTTGGATTCGAAGCTCGAGAACA
 
. : . : . : . : . : . :
JMFF015K16- GTTTGCTCATCCCATTTCGCGAAATCAAGGTTGAGTGTACAATACCTAAAGATGATGGCT
JMFF044K08- GTTTGCTCATACCATTCCGCGAAATCAAGGTTGAGTGTACGATACCAAAAGACGATGGGT
JMSF046J06- GTTTGCTCATACCATTCCGCGAAATCAAGGTTGAGTGTACGATACCAAAAGACGATGGGT
                      ____________________________________________________________
consensus GTTTGCTCATACCATTCCGCGAAATCAAGGTTGAGTGTACGATACCAAAAGACGATGGGT
 
. : . : . : . : . : . :
JMFF015K16- CCTTGGTGTCCTTTGTCGGGTTTCGAGTTCAACATGATAATGCTAGAGGCCCCATGAAAG
JMFF044K08- CATTGGCGAGTTTTGTGGGGTTTAGAGTTCAGCATGACAATGCTAGGGGTCCTATGAAAG
JMSF046J06- CATTGGCGAGTTTTGTGGGGTTTAGAGTTCAGCATGACAATGCTAGGGGTCCTATGAAAG
                      ____________________________________________________________
consensus CATTGGCGAGTTTTGTGGGGTTTAGAGTTCAGCATGACAATGCTAGGGGTCCTATGAAAG
 
. : . : . : . : . : . :
JMFF015K16- GTGGAATCAGATACCACCCGGAGGTTGATCCGGATGAAGTGAATGCATTAGCACAACTAA
JMFF044K08- GAGGGATCAGATACCATCCCGAGGTTGATCCAGATGAGGTGAATGCCTTAGCACAACTAA
JMSF046J06- GAGGGATCAGATACCATCCCGAGGTTGATCCAGATGAGGTGAATGCCTTAGCACAACTAA
                      ____________________________________________________________
consensus GAGGGATCAGATACCATCCCGAGGTTGATCCAGATGAGGTGAATGCCTTAGCACAACTAA
 
. : . : . : . : . : . :
JMFF015K16- TGACATGGAAAACAGCAGTGGCTAACATACCATATGGTGGGGCTAAAGGAGGGATAGGAT
JMFF044K08- TGACATGGAAGACAGCAGTAGCCAACATACCGTATGGCGGAGCCAAGGGCGGGATAGGAT
JMSF046J06- TGACATGGAAGACAGCAGTAGCCAACATACCGTATGGCGGAGCCAAGGGCGGGATAGGAT
                      ____________________________________________________________
consensus TGACATGGAAGACAGCAGTAGCCAACATACCGTATGGCGGAGCCAAGGGCGGGATAGGAT
 
. : . : . : . : . : . :
JMFF015K16- GCAATCCAAGCGAGCTGAGTGTCTCTGAGCTGGAACGACTTACTCGCGTTTTTACTCAGA
JMFF044K08- GCAATCCGAGCGAGCTGAGCTGCTCTGAACTGGAACGACTCACTCGAGTTTTTACCCAGA
JMSF046J06- GCAATCCGAGCGAGCTGAGCTGCTCTGAACTGGAACGACTCACTCGAGTTTTTACCCAGA
                      ____________________________________________________________
consensus GCAATCCGAGCGAGCTGAGCTGCTCTGAACTGGAACGACTCACTCGAGTTTTTACCCAGA
 
. : . : . : . : . : . :
JMFF015K16- AAATCCATGATCTGATTGGCGTCCAGATAGATGTCCCGGCTCCTGATATGGGAACAGGTC
JMFF044K08- AGATACATGATTTGATAGGCACCCACACCGATGTCCCAGCTCCTGATATGGGAACAGGTC
JMSF046J06- AGATACATGATTTGATAGGCACCCACACCGATGTCCCAGCTCCTGATATGGGAACAGGTC
                      ____________________________________________________________
consensus AGATACATGATTTGATAGGCACCCACACCGATGTCCCAGCTCCTGATATGGGAACAGGTC
 
. : . : . : . : . : . :
JMFF015K16- CGCAGACAATGGCATGGATTCTCGACGAGTACTCA
JMFF044K08- CACAGACNATGGCATGGATTCTGGATGAGTACTCANAGTTCCATGGCTATTC
JMSF046J06- CACAGACAATGGCATGGATTCTGGATGAGTACTCAAAGTTCCATGGCTATTCACCTGCAG
                      ____________________________________________________________
consensus CACAGACAATGGCATGGATTCTGGATGAGTACTCAAAGTTCCATGGCTATTCACCTGCAG
 
. : . : . : . : . : . :
JMSF046J06- TAGTAACAGGAAAACCTATTGATCTTGGAGGTTCTCTAGGTAGGGATGCCGCTACAGGGA
                      ____________________________________________________________
consensus TAGTAACAGGAAAACCTATTGATCTTGGAGGTTCTCTAGGTAGGGATGCCGCTACAGGGA
 
. : . : . : . : . : . :
JMSF046J06- GGGGCGTTCTCTTCGCAACAGAAGCCCTGCTCAACGAGCATGGCAAGAGCATTGCCGGGC
rJMSF046J06+ TTCGCAACAGAAGCCCTGCTCAACGAGCATGGCAAGAGCATTGCCGGGC
                      ____________________________________________________________
consensus GGGGCGTTCTCTTCGCAACAGAAGCCCTGCTCAACGAGCATGGCAAGAGCATTGCCGGGC
 
. : . : . : . : . : . :
JMSF046J06- AACGCTTTGTTATACAGGGATTTGGTAATGTTGGCTCGTGGGCGGCTCAACTGATCAGCG
rJMSF046J06+ AACGCTTTGTTATACAGGGATTTGGTAATGTTGGCTCGTGGGCGGCTCAACTGATCAGCG
                      ____________________________________________________________
consensus AACGCTTTGTTATACAGGGATTTGGTAATGTTGGCTCGTGGGCGGCTCAACTGATCAGCG
 
. : . : . : . : . : . :
JMSF046J06- AACAAGGTGGAAAGATTGTTGCTGTTAGTGATGTCACGGGTGCCATAAAGAACGAAAATG
rJMSF046J06+ AACAAGGTGGAAAGATTGTTGCTGTTAGTGATGTCACGGGTGCCATAAAGAACGAAAATG
                      ____________________________________________________________
consensus AACAAGGTGGAAAGATTGTTGCTGTTAGTGATGTCACGGGTGCCATAAAGAACGAAAATG
 
. : . : . : . : . : . :
JMSF046J06- GGATTGACATACCAAGCCTGATGAAACACGTGAA
rJMSF046J06+ GGATTGACATACCAAGCCTGATGAAACACGTGAAGGAGAACCGTGGAGTCAAAGGTTTCC
                      ____________________________________________________________
consensus GGATTGACATACCAAGCCTGATGAAACACGTGAAGGAGAACCGTGGAGTCAAAGGTTTCC
 
. : . : . : . : . : . :
rJMFF015K16+ C
rJMSF046J06+ ACGATGGAGTTGCTATAGATTCTAATTCGATATTGGTTGAAGATTGTGACATCCTCATCC
                      ____________________________________________________________
consensus ACGATGGAGTTGCTATAGATTCTAATTCGATATTGGTTGAAGATTGTGACATCCTCATCC
 
. : . : . : . : . : . :
rJMFF015K16+ CAGCTGCCCTGGGAGGNGTCATTAACAGGGATAATGCAAATGACATCAAAGCGAAATTCA
rJMSF046J06+ CAGCTGCCTTAGGAGGCGTGATTAACAGGGATAATGCAAAAGACATCAAAGCCAAGTTCA
                      ____________________________________________________________
consensus CAGCTGCCTTGGGAGGCGTGATTAACAGGGATAATGCAAATGACATCAAAGCGAAGTTCA
 
. : . : . : . : . : . :
rJMFF015K16+ TTGTTGAGGCCGCTAACCATCCAACTGATCCTGAAGCTGATGAGATTTTAGCAAAGAAAG
rJMSF046J06+ TCATTGAGGCAGCTAATCATCCAACTGATCCCGAAGCGGATGAGATTTTAGCGAAGAAAG
rJMFF044K08+ TTGAGGCAGCTAATCATCCAACTGATCCCGAAGCGGATGAGATTTTAGCGAAGAAAG
                      ____________________________________________________________
consensus TTGTTGAGGCAGCTAATCATCCAACTGATCCCGAAGCGGATGAGATTTTAGCGAAGAAAG
 
. : . : . : . : . : . :
rJMFF015K16+ GAGTTGTGATTCTACCAGACATCTATGCAAACTCAGGTGGAGTTACTGTCAGCTATTTTG
rJMSF046J06+ GAGTTGTCATTCTGCCAGACATATATGCAAATTCAGGTGGAGTCACTGTCAGTTATTTCG
rJMFF044K08+ GAGTTGTCATTCTGCCAGACATATATGCAAATTCAGGTGGAGTCACTGTCAGTTATTTCG
                      ____________________________________________________________
consensus GAGTTGTCATTCTGCCAGACATATATGCAAATTCAGGTGGAGTCACTGTCAGTTATTTCG
 
. : . : . : . : . : . :
rJMFF015K16+ AGTGGGTTCAGAACATTCAAGGGTTTATGTGGGATGAGGAGAAAGTGAATGCAGAACTTC
rJMSF046J06+ AATGGGTTCAGAACATTCAAGGCTTTATGTGGGACGAGGAGAAAGTGAATGCCGAACTGA
rJMFF044K08+ AATGGGTTCAGAACATTCAAGGCTTTATGTGGGACGAGGAGAAAGTGAATGCCGAACTGA
                      ____________________________________________________________
consensus AATGGGTTCAGAACATTCAAGGCTTTATGTGGGACGAGGAGAAAGTGAATGCCGAACTGA
 
. : . : . : . : . : . :
rJMFF015K16+ ATAAATATATGACCAGAGGTTTTAAAGATGTGAAGGATATGTGCAGCACCCACAACTGTG
rJMSF046J06+ AGACATATATGACCAGAGGTTTCAAGGACGTGAAGGATATGTGCAAAACCCACAACTGTG
rJMFF044K08+ AGACATATATGACCAGAGGTTTCAAGGACGTGAAGGATATGTGCAAAACCCACAACTGTG
                      ____________________________________________________________
consensus AGACATATATGACCAGAGGTTTCAAGGACGTGAAGGATATGTGCAAAACCCACAACTGTG
 
. : . : . : . : . : . :
rJMFF015K16+ ATCTTCGTATGGGTGCATTCACCTTAGGAGTTAACCGTGTAGCCCGGGCTACACTTCTTA
rJMSF046J06+ ACCTCCGTATGGGCGCTTTCACGCTAGGCGTTAATCGGGTTGCCAGGGCAACACTTCTGA
rJMFF044K08+ ACCTCCGTATGGGCGCTTTCACGCTAGGCGTTAATCGGGTTGCCAGGGCAACACTTTTGA
                      ____________________________________________________________
consensus ACCTCCGTATGGGCGCTTTCACGCTAGGCGTTAATCGGGTTGCCAGGGCAACACTTCTGA
 
. : . : . : . : . : . :
rJMFF015K16+ GGGGATGGG
rJMSF046J06+ GGGGATGGGAAGCTTGAAAACCGGATGCATAAATGCATAATCACCGCTTTTTTCTTGAAT
rJMFF044K08+ GGGGATGGGAAGCTTGAAAACCGGATGCATAAATGCATAATCACCGCTTTTTTCTTGAAT
                      ____________________________________________________________
consensus GGGGATGGGAAGCTTGAAAACCGGATGCATAAATGCATAATCACCGCTTTTTTCTTGAAT
 
. : . : . : . : . : . :
rJMSF046J06+ AAAGGAAGGCTCCAAGAATCCCGAATCCCCTCACCCTCTATCCAATTCTAATTCATTCCA
rJMFF044K08+ AAAGGAAGGCTCCAAGAATCCCGAATCCCCTCACCCTCTATCCAATTTTAATTCATTCCA
                      ____________________________________________________________
consensus AAAGGAAGGCTCCAAGAATCCCGAATCCCCTCACCCTCTATCCAATTTTAATTCATTCCA
 
. : . : . : . : . : . :
rJMSF046J06+ AACTCTGCAATAGAGTTCTGGCAAATGCCTCTTTTTTTTGTGTGTTTGAC
rJMFF044K08+ AACTCTGCAATAGAGTTCTGGCAAATGCCTCTTTTTTTTGTGTGTTTGACAATGTAACAT
                      ____________________________________________________________
consensus AACTCTGCAATAGAGTTCTGGCAAATGCCTCTTTTTTTTGTGTGTTTGACAATGTAACAT
 
. : . : . : . : . : . :
rJMFF044K08+ GTTTCTTTTCTTGTTATGAGTTATATATTCCCCTGGATTTCTAAAAAAAAAAAAAAAAAG
                      ____________________________________________________________
consensus GTTTCTTTTCTTGTTATGAGTTATATATTCCCCTGGATTTCTAAAAAAAAAAAAAAAAAG