Previous Contig 010444:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009N10Sequence568005955 (5)gb:AP004092_18375729e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15764010444 (3)gb:AP004092_18375729e-43Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15
JMFF044J16Sequence648005955 (5)gb:AP004092_18375721e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15611010444 (3)gb:AP004092_18375724e-11Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15
JMSF021C12Sequence651005955 (5)gb:AP004092_18375729e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15748010444 (3)gb:AP004092_18375727e-67Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ15

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF021C12+ TCCCGAG
                      ____________________________________________________________
consensus TCCCGAG
 
. : . : . : . : . : . :
rJMSF021C12+ ATTTACAATAGTGATTTTACTACTCCTCTGCCTGCTATAATAGACAAATGCATTCAGTCT
                      ____________________________________________________________
consensus ATTTACAATAGTGATTTTACTACTCCTCTGCCTGCTATAATAGACAAATGCATTCAGTCT
 
. : . : . : . : . : . :
rJMSF021C12+ GCACCAATAGACACAAGAAGAGCCCTGTACAAGAATATAGTTTTGTCTGGCGGATCAACC
                      ____________________________________________________________
consensus GCACCAATAGACACAAGAAGAGCCCTGTACAAGAATATAGTTTTGTCTGGCGGATCAACC
 
. : . : . : . : . : . :
rJMSF021C12+ ATGTTCAAAGATTTCCATAGAAGATTGCAACGAGATTTAAAGAAGATAGTTGATGCTCGT
rJMFF009N10+ CAAAGATTTCCATAGAAGATTGCAACGAGATTTAAAGAAGATAGTTGATGCTCGT
                      ____________________________________________________________
consensus ATGTTCAAAGATTTCCATAGAAGATTGCAACGAGATTTAAAGAAGATAGTTGATGCTCGT
 
. : . : . : . : . : . :
rJMSF021C12+ GTTCTTGCATCAGATGCTCGGTTGGGTGGAGAAATCAAAGCACAACCGGTGGAAGTAAAT
rJMFF009N10+ GTTCTTGCATCAGATGCTCGGTTGGGTGGAGAAATCAAAGCACAACCGGTGGAAGTAAAT
                      ____________________________________________________________
consensus GTTCTTGCATCAGATGCTCGGTTGGGTGGAGAAATCAAAGCACAACCGGTGGAAGTAAAT
 
. : . : . : . : . : . :
rJMSF021C12+ GTGGTCAGCCATCCAATACAGAGATATGCAGTTTGGTTCGGAGGATCTGTGCTTGCATCC
rJMFF009N10+ GTGGTCAGCCATCCAATACAGAGATATGCAGTTTGGTTCGGAGGATCTGTGCTTGCATCC
rJMFF044J16+ GTGCTTGCATCC
                      ____________________________________________________________
consensus GTGGTCAGCCATCCAATACAGAGATATGCAGTTTGGTTCGGAGGATCTGTGCTTGCATCC
 
. : . : . : . : . : . :
rJMSF021C12+ ACTCCTGAATTTTTTGCGGCTTGCCATACGAAAGCAGAGTATGAGGAGTATGGAGCCAGC
rJMFF009N10+ ACTCCTGAATTTTTTGCGGCTTGCCATACGAAAGCAGAGTATGAGGAGTATGGAGCCAGC
rJMFF044J16+ ACTCCTGAATTTTNTGCGGCTTGCCATACGAAAGCAGAGTATGAGGAGTATGGAGCCAGC
                      ____________________________________________________________
consensus ACTCCTGAATTTTTTGCGGCTTGCCATACGAAAGCAGAGTATGAGGAGTATGGAGCCAGC
 
. : . : . : . : . : . :
rJMSF021C12+ ATATGCCGCACAAACCCTGTATTTAAGGGAATGTATTGATATGGAGGCCATTTGAAATTT
rJMFF009N10+ ATATGCCGCACAAACCCTGTATTTAAGGGAATGTATTGATATGGAGGCCATTTGAAATTT
rJMFF044J16+ ATATGCCGCACAAACCCTGTATNTAAGGGAATGTATTGATATGGAGGCCATTTGAAATTT
                      ____________________________________________________________
consensus ATATGCCGCACAAACCCTGTATTTAAGGGAATGTATTGATATGGAGGCCATTTGAAATTT
 
. : . : . : . : . : . :
rJMSF021C12+ GAACTTGATGATTATAAAGAAATCTGTTGGTATCATGTTCACTTGAAAAGGTCAACCATT
rJMFF009N10+ GAACTTGATGATTATAAAGAAATCTGTTGGTATCATGTTCACTTGAAAAGGTCAACCATT
rJMFF044J16+ GAACTTGATGATTATAAAGAAATCTGTTGGTATCATGTTCACTTGAAAAGGTCAACCATT
                      ____________________________________________________________
consensus GAACTTGATGATTATAAAGAAATCTGTTGGTATCATGTTCACTTGAAAAGGTCAACCATT
 
. : . : . : . : . : . :
rJMSF021C12+ CCAAGTTCACATGAGTTAATTTCTTCGAAATCCCAATCCAAAATCACATTGATGTATGCT
rJMFF009N10+ CCAAGTTCACATGAGTTAATTTCTTCGAAATCCCAATCCAAAATCACATTGATGTATGCT
rJMFF044J16+ CCAAGTTCACATGAGTTAATTTCTTCGAAATCCCAATCCAAAATCACATTGATGTATGCT
                      ____________________________________________________________
consensus CCAAGTTCACATGAGTTAATTTCTTCGAAATCCCAATCCAAAATCACATTGATGTATGCT
 
. : . : . : . : . : . :
rJMSF021C12+ TCCAGCTGGCTAGAGGCTTGTATAGATAGACTTGTTGATTCTTGCTTTATAGGAAACCTC
rJMFF009N10+ TCCAGCTGGCTAGAGGCTTGTATAGATAGACTTGTTGATTCTTGCTTTATAGGAAACCTC
rJMFF044J16+ TCCAGCTGGCTAGAGGCTTGTATAGATAGACTTGTTGATTCTTGCTTTATAGGAAACCTC
                      ____________________________________________________________
consensus TCCAGCTGGCTAGAGGCTTGTATAGATAGACTTGTTGATTCTTGCTTTATAGGAAACCTC
 
. : . : . : . : . : . :
rJMSF021C12+ TACCTTCATGCAGGAACCCTTTGGTCAATGCTTTTCCAGAAAAGTTGGTTTGATTTTGGA
rJMFF009N10+ TACCTTCATGCAGGAACCCTTTGGTCAATGCTTTTCCAGAAAAGTTGGTTTGATTTTGGA
rJMFF044J16+ TACCTTCATGCAGGAACCCTTTGGTCAATGCTTTTCCAGAAAAGTTGGTTTGATTTTGGA
                      ____________________________________________________________
consensus TACCTTCATGCAGGAACCCTTTGGTCAATGCTTTTCCAGAAAAGTTGGTTTGATTTTGGA
 
. : . : . : . : . : . :
rJMSF021C12+ AGCTACTGAGCTGAATGTGATTATCTCAGCGTTCGCCTTTTAGCTTCATAAAGTTCTTAC
rJMFF009N10+ AGCTACTGAGCTGAATGTGATTATCTCAGCGTTCGCCTTTTAGCTTCATAAAGTTCTTA-
rJMFF044J16+ AGCTACTGAGCTGAATGTGATTATCTCAGCGTTCGCCTTTTAGCTTCATAAAGTTCTTA-
                      ____________________________________________________________
consensus AGCTACTGAGCTGAATGTGATTATCTCAGCGTTCGCCTTTTAGCTTCATAAAGTTCTTA-
 
. : . : . : . : . : . :
rJMSF021C12+ CAGTATAACTCAGATAATTAT
rJMFF009N10+ CAGTATAACTCAGATAATTATGTTATTTCATTCGTTGAAAGATTGATATTTGATTAGAGG
rJMFF044J16+ CAGTATAACTCAGATAATTATGTTATTTCATTCGTTGAAAGATTGATATTTGATTAGAGG
                      ____________________________________________________________
consensus CAGTATAACTCAGATAATTATGTTATTTCATTCGTTGAAAGATTGATATTTGATTAGAGG
 
. : . : . : . : . : . :
rJMFF009N10+ TTTAGAATCATGGTTTTGGTTGCAATTTGTCCAAAAGTCCGTCCTTGTATGTACTGTTCG
rJMFF044J16+ TTTAGAATCATGGTTTTGGTTGCAATTTGTCCAAAAGTCCGTCCTTGTATGTACTGTTCG
                      ____________________________________________________________
consensus TTTAGAATCATGGTTTTGGTTGCAATTTGTCCAAAAGTCCGTCCTTGTATGTACTGTTCG
 
. : . : . : . : . : . :
rJMFF009N10+ TTAGAAAAATTCTTGTCATTTTCCTGGGATAGCTAATGTATACAAA
rJMFF044J16+ TTAGAAAAATTCTTGTCATTTTCCTGGGATAGCTAATGTATACAAATGGATTTTTGTATC
                      ____________________________________________________________
consensus TTAGAAAAATTCTTGTCATTTTCCTGGGATAGCTAATGTATACAAATGGATTTTTGTATC