Previous Contig 010443:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001N24Sequence345010443 (8)gb:ATAC011708_15433881e-17Arabidopsis thaliana chromosome III BAC T7M13 genomic sequence, complete sequenc769010443 (8)gb:ATAC011708_15433889e-65Arabidopsis thaliana chromosome III BAC T7M13 genomic sequence, complete sequenc
JMFF013L11Sequence432010443 (8)gb:ATAC011708_15433881e-32Arabidopsis thaliana chromosome III BAC T7M13 genomic sequence, complete sequenc765010443 (8)gb:ATAC011708_15433884e-57Arabidopsis thaliana chromosome III BAC T7M13 genomic sequence, complete sequenc
JMFF021I01Sequence230010443 (8)gb:ATAC011708_15433886e-11Arabidopsis thaliana chromosome III BAC T7M13 genomic sequence, complete sequenc513010443 (8)gb:ATAC011708_15433882e-41Arabidopsis thaliana chromosome III BAC T7M13 genomic sequence, complete sequenc
JMFF044J14Sequence650010443 (8)gb:ATAC011708_15433882e-54Arabidopsis thaliana chromosome III BAC T7M13 genomic sequence, complete sequenc569010443 (8)gb:ATAC011708_15433889e-32Arabidopsis thaliana chromosome III BAC T7M13 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF021I01- GGGCAGAGAGATAGAGACACAGAGA
JMFF013L11- GAGAGATAGAGACACAGAGA
JMFF001N24- GAGAGATAGAGACACAGAGA
rJMFF021I01+ GCAGAGAGATAGAGACACAGAGA
JMFF044J14- GAGAGATAGAGACACAGAGA
                      ____________________________________________________________
consensus GGGCAGAGAGATAGAGACACAGAGA
 
. : . : . : . : . : . :
JMFF021I01- AAGGGAAGAGAGGGCAATAATAATGGGGGGAGAGTCCTTTGAAACGAAGAAGACGGCGGA
JMFF013L11- AAGGGAAGAGAGGGCAATAATAATGGGGGGAGAGTCCTTTGAAACGAAGAAGACGGCGGA
JMFF001N24- AAGGGAAGAGAGGGCAATAATAATGGGGGGAGAGTCCTTTGAAACGAAGAAGACGGCGGA
rJMFF021I01+ AAGGGAAGAGAGGGCAATAATAATGGGGGGAGAGTCCTTTGAAACGAAGAAGACGGCGGA
JMFF044J14- AAGGGAAGAGAGGGCAATAATAATGGGGGGAGAGTCCTTTGAAACGAAGAAGACGGCGGA
                      ____________________________________________________________
consensus AAGGGAAGAGAGGGCAATAATAATGGGGGGAGAGTCCTTTGAAACGAAGAAGACGGCGGA
 
. : . : . : . : . : . :
JMFF021I01- GGAGAAGATTAGGGA-GGAGGTGGTGGCGCCGCCGCCGCCGCCACACTTCGTTCTGGTTC
JMFF013L11- GGAGAAGATTAGGGAGGGAGGTGGTGGCGCCGCCGCCGCCGCCACACTTCGTTCTGGTTC
JMFF001N24- GGAGAAGATTAGGGA-GGAGGTGGTGGCGCCGCCGCCGCCGCCACACTTCGTTCTGGTTC
rJMFF021I01+ GGAGAAGATTAGGGA-GGAGGTGGTGGCGCCGCCGCCGCCGCCACACTTCGTTCTGGTTC
JMFF044J14- GGAGAAGATTAGGGA-GGAGGTGGTGGCGCCGCCGCCGCCGCCACACTTCGTTCTGGTTC
                      ____________________________________________________________
consensus GGAGAAGATTAGGGA-GGAGGTGGTGGCGCCGCCGCCGCCGCCACACTTCGTTCTGGTTC
 
. : . : . : . : . : . :
JMFF021I01- ATGGACTTGGCGGAGGAGCTTGGTGCTGGTACAAGCTCCGGTGTCTCNTGGAGAATTCCG
JMFF013L11- ATGGACTTGGCGGAGGAGCTTGGTGCTGGTACAAGCTCCGGTGTCTCATGGAGAATTCCG
JMFF001N24- ATGGACTTGGCGGAGGAGCTTGGTGCTGGTACAAGCTCCGGTGTCTCATGGAGAATTCCG
rJMFF021I01+ ATGGACTTGGCGGAGGAGCTTGGTGCTGGTACAAGCTCCGGTGTCTCATGGAGAATTCCG
JMFF044J14- ATGGACTTGGCGGAGGAGCTTGGTGCTGGTACAAGCTCCGGTGTCTCATGGAGAATTCCG
                      ____________________________________________________________
consensus ATGGACTTGGCGGAGGAGCTTGGTGCTGGTACAAGCTCCGGTGTCTCATGGAGAATTCCG
 
. : . : . : . : . : . :
JMFF021I01- GCTACCCAGTCTCCTGTATTGACCTC
JMFF013L11- GCTACAAAGTCTCCTGTATTGACCTCAGCAGCGCCGGCGTTGACCCCTCCGACGCTAACG
JMFF001N24- GCTACAAAGTCTCCTGTATTGACCTCAGCAGCGCCGGCGTTGACCCCTCCGACGCTAACG
rJMFF021I01+ GCTACAAAGTCTCCTGTATTGACCTCAGCAGCGCCGGCGTTGACCCCTCCGACGCTAACG
JMFF044J14- GCTACAAAGTCTCCTGTATTGACCTCAGCAGCGCCGGCGTTGACCCCTCCGACGCTAACG
rJMFF001N24+ GCGTTGACCCNTCNGACGCTAACG
                      ____________________________________________________________
consensus GCTACAAAGTCTCCTGTATTGACCTCAGCAGCGCCGGCGTTGACCCCTCCGACGCTAACG
 
. : . : . : . : . : . :
JMFF013L11- ACATCCTCAC-TTTCGACGATTACAACAAACCCCTCCTCGATTTCCTGGCTTCCTTGCCA
JMFF001N24- ACATCCTCAC-TTTCNACGATTACAACNAACCCCTCCTCNATTTCCTGGCTTCCTTGCCA
rJMFF021I01+ ACATCCTCAC-TTTCGACGATTACAACAAACCCCTCCTCGATTTCCTGGCTTCCTTGCCA
JMFF044J14- ACATCCTCAC-TTTCGACGATTACAACAAACCCCTCCTCGATTTCCTGGCTTCCTTGCCA
rJMFF001N24+ ACATCCTCACTTTTCGACGATTACAACAAACCCCTCCTCGATTTCCTGGCTTCCTTGCCA
                      ____________________________________________________________
consensus ACATCCTCAC-TTTCGACGATTACAACAAACCCCTCCTCGATTTCCTGGCTTCCTTGCCA
 
. : . : . : . : . : . :
JMFF013L11- CCAAATCAACAGGTGATATTGGTAGGGCATANCGCACGAGGGCTGAGCGTTACAGATGCG
JMFF001N24- CCNAATCNACAGGTGATATTGGT
rJMFF021I01+ CCAAATCAACAGGTGATATTGGTAGGGCATAGCGCAGGAGGGCTGAGCGTTACAGATGCG
JMFF044J14- CCAAATCAACAGGTGATATTGGTAGGGCATAGCGCAGGAGGGCTGAGCGTTACAGATGCG
rJMFF001N24+ CCAAATCAACAGGTGATATTGGTAGGGCATAGCGCAGGAGGGCTGAGCGTTACAGATGCG
rJMFF013L11+ ATCAACAGGTGATATTGGTAGGGCATAGCGCAGGAGGGCTGAGCGTTACAGATGCG
                      ____________________________________________________________
consensus CCAAATCAACAGGTGATATTGGTAGGGCATAGCGCAGGAGGGCTGAGCGTTACAGATGCG
 
. : . : . : . : . : . :
JMFF013L11- ACTCACNAGTTTCCCCANAAGATCANCCTANCAATCTACNTCGCANCAAC
rJMFF021I01+ ACTCACAAGTTTCCCCAGAAGATCAGCCTAGCAATCTACATCGCAGCAACAATGCTCAAA
JMFF044J14- ACTCACAAGTTTCCCCAGAAGATCAGCCTAGCAATCTACATCGCAGCAACAATGCTCAAA
rJMFF001N24+ ACTCACAAGTTTCCCCAGAAGATCAGCCTAGCAATCTACATCGCAGCAACAATGCTCAAA
rJMFF013L11+ ACTCACAAGTTTCCCCAGAAGATCAGCCTAGCAATCTACATCGCAGCAACAATGCTCAAA
                      ____________________________________________________________
consensus ACTCACAAGTTTCCCCAGAAGATCAGCCTAGCAATCTACATCGCAGCAACAATGCTCAAA
 
. : . : . : . : . : . :
rJMFF021I01+ ACTGGCTTCACCTCTGAACAAGACATCAAAGATG
JMFF044J14- ACTGGCTTCACCTCTGAACAAGACATCAAAGATGGAATTCCGGATTTATCGGATTTTGGA
rJMFF001N24+ ACTGGCTTCACCTCTGAACAAGACATCAAAGATGGAATTCCGGATTTATCGGATTTTGGA
rJMFF013L11+ ACTGGCTTCACCTCTGAACAAGACATCAAAGATGGAATTCCGGATTTATCGGATTTTGGA
                      ____________________________________________________________
consensus ACTGGCTTCACCTCTGAACAAGACATCAAAGATGGAATTCCGGATTTATCGGATTTTGGA
 
. : . : . : . : . : . :
JMFF044J14- GAAATCAATGAAGTGTATGACATCGGTTTCGGGATGGGCCAAGATGGGCCTCCGACCAGT
rJMFF001N24+ GAAATCAATGAAGTGTATGACATCGGTTTCGGGATGGGCCAAGATGGGCCTCCGACCAGT
rJMFF013L11+ GAAATCAATGAAGTGTATGACATCGGTTTCGGGATGGGCCAAGATGGGCCTCCGACCAGT
rJMFF044J14+ GGATGGGCCAAGATGGGCCTCCGACCAGT
                      ____________________________________________________________
consensus GAAATCAATGAAGTGTATGACATCGGTTTCGGGATGGGCCAAGATGGGCCTCCGACCAGT
 
. : . : . : . : . : . :
JMFF044J14- ATACTCGTCACTAAAACATTACAACGTAAAATTCTGTACC-AATGAGTCCACTCGAGGAT
rJMFF001N24+ ATACTCGTCACTAAAACATTACAACGTAAAATTCTGTACCAAATGAGTCCACTCGAGGAT
rJMFF013L11+ ATACTCGTCACTAAAACATTACAACGTAAAATTCTGTACCAAATGAGTCCACTCGAGGAT
rJMFF044J14+ ATACTCGTCACTAAAACATTACAACGTAAAATTCTGTACCAAATGAGTCCACTCGAGGAT
                      ____________________________________________________________
consensus ATACTCGTCACTAAAACATTACAACGTAAAATTCTGTACCAAATGAGTCCACTCGAGGAT
 
. : . : . : . : . : . :
JMFF044J14- TCAACGTTGGCGGGAATGTTACTA
rJMFF001N24+ TCAACGTTGGCGGGAATGTTACTAAGACCCGGACCGATCAAAGCGTTGGCGAGTGCAGAG
rJMFF013L11+ TCAACGTTGGCGGGAATGTTACTAAGACCCGGACCGATCAAAGCGTTGGCGAGTGCAGAG
rJMFF044J14+ TCAACGTTGGCGGGAATGTTACTAAGACCCGGACCGATCAAAGCGTTGGCGAGTGCAGAG
                      ____________________________________________________________
consensus TCAACGTTGGCGGGAATGTTACTAAGACCCGGACCGATCAAAGCGTTGGCGAGTGCAGAG
 
. : . : . : . : . : . :
rJMFF001N24+ TTCATGGAATCTGAGGGTGTAGAACATGTTCCTCGGATTTACATTAGAACGAGGTACGAC
rJMFF013L11+ TTCATGGAATCTGAGGGTGTAGAACATGTTCCTCGGATTTACATTAGAACGAGGTACGAC
rJMFF044J14+ TTCATGGAATCTGAGGGTGTAGAACATGTTCCTCGGATTTACATTAGAACGAGGTACGAC
                      ____________________________________________________________
consensus TTCATGGAATCTGAGGGTGTAGAACATGTTCCTCGGATTTACATTAGAACGAGGTACGAC
 
. : . : . : . : . : . :
rJMFF001N24+ AATGTGGTTAAGCCGGAGCAGCAAGATGCAATGATCAACAAGTGGCCGCCAGCCAGCGTG
rJMFF013L11+ AATGTGGTTAAGCCGGAGCAGCAAGATGCAATGATCAACAAGTGGCCGCCAGCCAGCGTG
rJMFF044J14+ AATGTGGTTAAGCCGGAGCAGCAAGATGCAATGATCAACAAGTGGCCGCCAGCCAGCGTG
                      ____________________________________________________________
consensus AATGTGGTTAAGCCGGAGCAGCAAGATGCAATGATCAACAAGTGGCCGCCAGCCAGCGTG
 
. : . : . : . : . : . :
rJMFF001N24+ TACACTTTGGATAGCGACCATAGCCCTTTCTTCTCCGCCCCATTTGCACTCTTTGGTTTG
rJMFF013L11+ TACACTTTGGATAGCGACCATAGCCCTTTCTTCTCCGCCCCATTTGCACTCTTTGGTTTG
rJMFF044J14+ TACACTTTGGATAGCGACCATAGCCCTTTCTTCTCCGCCCCATTTGCACTCTTTGGTTTG
                      ____________________________________________________________
consensus TACACTTTGGATAGCGACCATAGCCCTTTCTTCTCCGCCCCATTTGCACTCTTTGGTTTG
 
. : . : . : . : . : . :
rJMFF001N24+ TTGGTTAAAGCAACATCATCAGAAAAGTCTATAGTTGTTATCTAAGTGTGTGTTTAGATT
rJMFF013L11+ TTGGTTAAAGCAACATCATCAGAAAAGTCTATAGTTGTTATCTAAGTGTGTGTTTAGATT
rJMFF044J14+ TTGGTTAAAGCAACATCATCAGAAAAGTCTATAGTTGTTATCTAAGTGTGTGTTTAGATT
                      ____________________________________________________________
consensus TTGGTTAAAGCAACATCATCAGAAAAGTCTATAGTTGTTATCTAAGTGTGTGTTTAGATT
 
. : . : . : . : . : . :
rJMFF001N24+ GAACCATGTCTTGTGACTTTTGTTGCCACCCGTCTAGGTTGTCTATAATTATATATTGAC
rJMFF013L11+ GAACCATGTCTTGTGACTTTTGTTGCCACCCGTCTAGGTTGTCTATAATTATATATTGAC
rJMFF044J14+ GAACCATGTCTTGTGACTTTTGTTGCCACCCGTCTAGGTTGTCTATAATTATATATTGAC
                      ____________________________________________________________
consensus GAACCATGTCTTGTGACTTTTGTTGCCACCCGTCTAGGTTGTCTATAATTATATATTGAC
 
. : . : . : . : . : . :
rJMFF001N24+ TGGCCGAAACCAATAATAAGGCAAT
rJMFF013L11+ TGGCCGAAACCAATAATAAGGCAATAGAAAGCTCTCGTAGTGATCAAACTTAAAATTTTG
rJMFF044J14+ TGGCCGAAACCAATAATAAGGCAATAGAAAGCTCTCGTAGTGATCAAACTTAAAATTTTG
                      ____________________________________________________________
consensus TGGCCGAAACCAATAATAAGGCAATAGAAAGCTCTCGTAGTGATCAAACTTAAAATTTTG
 
. : . : . : . : . : . :
rJMFF013L11+ CAGTTATAATTCTTTGATGAACAATTATTATGATGTTAT
rJMFF044J14+ CAGTTATAATTCTTTGATGAACAATTATTATGATGTTATTGCATAATAAAATTAATTTCC
                      ____________________________________________________________
consensus CAGTTATAATTCTTTGATGAACAATTATTATGATGTTATTGCATAATAAAATTAATTTCC