Previous Contig 010437:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF039N01Sequence492010437 (4)pir|B71412|B714122e-34ferredoxin [2Fe-2S] - Arabidopsis thaliana>gb:ATCHRIV40_1545291 Arabidopsis thal698010437 (4)pir|B71412|B714121e-46ferredoxin [2Fe-2S] - Arabidopsis thaliana>gb:ATCHRIV40_1545291 Arabidopsis thal
JMFF044H19Sequence617010437 (4)pir|B71412|B714129e-47ferredoxin [2Fe-2S] - Arabidopsis thaliana>gb:ATCHRIV40_1545291 Arabidopsis thal604010437 (4)pir|B71412|B714129e-47ferredoxin [2Fe-2S] - Arabidopsis thaliana>gb:ATCHRIV40_1545291 Arabidopsis thal

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF039N01+ TCGAGANCNTCCCACGGTTTCTCGAGT
                      ____________________________________________________________
consensus TCGAGANCNTCCCACGGTTTCTCGAGT
 
. : . : . : . : . : . :
JMFF039N01- AAATCTGTGCAATAACTTCTCACTAAAAAACCTTATCCTATCCTACA
rJMFF039N01+ CATCGNTGATCCAAAATCTGTGCAATAACTTCTCANTAAAAAACCTTATCCTATCCTACA
                      ____________________________________________________________
consensus CATCGNTGATCCAAAATCTGTGCAATAACTTCTCACTAAAAAACCTTATCCTATCCTACA
 
. : . : . : . : . : . :
JMFF039N01- CCAAGCATTTCTCACCACACCAAAAACTGCTCCACTTCAGTTCCAGCACCAGAACACAAA
rJMFF039N01+ CCAAGCATTTCTCACCACACCAAAAACTGCTCCACTTCAGTTCCAGCACCAGAACACAAA
JMFF044H19- ACACCAAAAACTGCTCCACTTCAGTTCCAGCACCAGAACACAAA
rJMFF044H19+ CAAA
                      ____________________________________________________________
consensus CCAAGCATTTCTCACCACACCAAAAACTGCTCCACTTCAGTTCCAGCACCAGAACACAAA
 
. : . : . : . : . : . :
JMFF039N01- ACCAAAACCATGGCAACACTTCACTTTCCAACAACCCCTTCCTTCACGCTCACCACTCCA
rJMFF039N01+ ACCAAAACCATGGCAACACTTCACTTTCCAACAACCCCTTCCTTCACGCTCACCACTCCA
JMFF044H19- ACCAAAACCATGGCAACACTTCACTTTCCAACAACCCCTTCCTTCACGCTCACCACTCCA
rJMFF044H19+ ACCAAAACCATGGCAACACTTCACTTTCCAACAACCCCTTCCTTCACGCTCACCACTCCA
                      ____________________________________________________________
consensus ACCAAAACCATGGCAACACTTCACTTTCCAACAACCCCTTCCTTCACGCTCACCACTCCA
 
. : . : . : . : . : . :
JMFF039N01- AGAAAGCAGGTCAGCCTCCCTGCAATCCAGCAGAGCAGCCGGTTTCCCCATACGACCCCA
rJMFF039N01+ AGAAAGCAGGTCAGCCTCCCTGCAATCCAGCAGAGCAGCCGGTTTCCCCATACGACCCCA
JMFF044H19- AGAAAGCAGGTCAGCCTCCCTGCAATCCAGCAGAGCAGCCGGTTTCCCCATACGACCCCA
rJMFF044H19+ AGAAAGCAGGTCAGCCTCCCTGCAATCCAGCAGAGCAGCCGGTTTCCCCATACGACCCCA
                      ____________________________________________________________
consensus AGAAAGCAGGTCAGCCTCCCTGCAATCCAGCAGAGCAGCCGGTTTCCCCATACGACCCCA
 
. : . : . : . : . : . :
JMFF039N01- GGCCGTCGCCTATCCTGCATTCCCCGGGCTTACAAAGTGTTAGTTGAACATGAGGGTAAA
rJMFF039N01+ GGCCGTCGCCTATCCTGCATTCCCCGGGCTTACAAAGTGTTAGTTGAACATGAGGGTAAA
JMFF044H19- GGCCGTCGCCTATCCTGCATTCCCCGGGCTTACAAAGTGTTAGTTGAACATGAGGGTAAA
rJMFF044H19+ GGCCGTCGCCTATCCTGCATTCCCCGGGCTTACAAAGTGTTAGTTGAACATGAGGGTAAA
                      ____________________________________________________________
consensus GGCCGTCGCCTATCCTGCATTCCCCGGGCTTACAAAGTGTTAGTTGAACATGAGGGTAAA
 
. : . : . : . : . : . :
JMFF039N01- ACAACTGAGCTAGAGGTTGAACCTGATGAGAGCATTCTTTCCAAGGCATTGGACTCTGGC
rJMFF039N01+ ACAACTGAGCTAGAGGTTGAACCTGATGAGAGCATTCTTTCCAAGGCATTGGACTCTGGC
JMFF044H19- ACAACTGAGCTAGAGGTTGAACCTGATGAGAGCATTCTTTCCAAGGCATTGGACTCTGGC
rJMFF044H19+ ACAACTGAGCTAGAGGTTGAACCTGATGAGAGCATTCTTTCCAAGGCATTGGACTCTGGC
                      ____________________________________________________________
consensus ACAACTGAGCTAGAGGTTGAACCTGATGAGAGCATTCTTTCCAAGGCATTGGACTCTGGC
 
. : . : . : . : . : . :
JMFF039N01- TTGTCTGTGCCACATGACTGCAAACTAGGGGTGTGCATGACCTGCCCAGCTCGGCTTCTC
rJMFF039N01+ TTGTCTGTGCCACATGACTGCAAACTAGGGGTGTGCATGACCTGCCCAGCTCGGCTTCTC
JMFF044H19- TTGTCTGTGCCACATGACTGCAAACTAGGGGTGTGCATGACCTGCCCAGCTCGGCTTCTC
rJMFF044H19+ TTGTCTGTGCCACATGACTGCAAACTAGGGGTGTGCATGACCTGCCCAGCTCGGCTTCTC
                      ____________________________________________________________
consensus TTGTCTGTGCCACATGACTGCAAACTAGGGGTGTGCATGACCTGCCCAGCTCGGCTTCTC
 
. : . : . : . : . : . :
JMFF039N01- AGCGGAACAGTGGATCAGAGCGATGGAATGCTTAGTGATGATGTTGTGGAGAGCGGGTAC
rJMFF039N01+ AGCGGAACAGTGGATCAGAGCGATGGAATGCTTAGTGATGATGTTGTGGAGAGCGGGTAC
JMFF044H19- AGCGGAACAGTGGATCAGAGCGATGGAATGCTTAGTGATGATGTTGTGGAGAGCGGGTAC
rJMFF044H19+ AGCGGAACAGTGGATCAGAGCGATGGAATGCTTAGTGATGATGTTGTGGAGAGCGGGTAC
                      ____________________________________________________________
consensus AGCGGAACAGTGGATCAGAGCGATGGAATGCTTAGTGATGATGTTGTGGAGAGCGGGTAC
 
. : . : . : . : . : . :
JMFF039N01- GCTTTACTCTGTGCAGCTTATCCAA
rJMFF039N01+ GCTTTACTCTGTGCAGCTTATCCAAGATCAGATTGCCATATTAGGGTCATACCTGAAGAA
JMFF044H19- GCTTTACTCTGTGCAGCTTATCCAAGATCAGATTGCCATATTAGGGTCATACCTGAAGAA
rJMFF044H19+ GCTTTACTCTGTGCAGCTTATCCAAGATCAGATTGCCATATTAGGGTCATACCTGAAGAA
                      ____________________________________________________________
consensus GCTTTACTCTGTGCAGCTTATCCAAGATCAGATTGCCATATTAGGGTCATACCTGAAGAA
 
. : . : . : . : . : . :
rJMFF039N01+ GAGCTGCTGTCACTGCAGCTAGCAACTGCCAATGACTAAACGCTAAGAGTGTCTGTTTGT
JMFF044H19- GAGCTGCTGTCACTGCAGCTAGCAACTGCCAATGACTAAACGCTAAGAGTGTCTGTTTGT
rJMFF044H19+ GAGCTGCTGTCACTGCAGCTAGCAACTGCCAATGACTAAACGCTAAGAGTGTCTGTTTGT
                      ____________________________________________________________
consensus GAGCTGCTGTCACTGCAGCTAGCAACTGCCAATGACTAAACGCTAAGAGTGTCTGTTTGT
 
. : . : . : . : . : . :
rJMFF039N01+ TCCCATTTTTTGTGGATTGATAAGATGATGTAACACATTTATATGTATTGACTAAGGCTT
JMFF044H19- TCCCATTTTTTGTGGATTGATAAGATGATGTAACACATTTATATGTATTGACTAAGGCTT
rJMFF044H19+ TCCCATTTTTTGTGGATTGATAAGATGATGTAACACATTTATATGTATTGACTAAGGCTT
                      ____________________________________________________________
consensus TCCCATTTTTTGTGGATTGATAAGATGATGTAACACATTTATATGTATTGACTAAGGCTT
 
. : . : . : . : . : . :
JMFF044H19- TGAATCANAAACATGTGTTGCTTACTGCTA
rJMFF044H19+ TGAATCAAAAACATGTGTTGCTTACTGCTAAATAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TGAATCAAAAACATGTGTTGCTTACTGCTAAATAAAAAAAAAAAAAAAACTCTCCAGGGT