Previous Contig 010433:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009H11Sequence561001895 (4)pir|T47873|T478739e-05phosphatidate cytidylyltransferase-like protein - Arabidopsis thaliana>gb:ATT4C2783010433 (4)gb:AY050778_15622877e-68Arabidopsis thaliana putative phosphatidate cytidylyltransferase (At2g45150) mRN
JMFF037P14Sequence528001895 (4)234010433 (4)pir|T47873|T478734e-07phosphatidate cytidylyltransferase-like protein - Arabidopsis thaliana>gb:ATT4C2
JMFF044H12Sequence638001895 (4)pir|T47873|T478739e-16phosphatidate cytidylyltransferase-like protein - Arabidopsis thaliana>gb:ATT4C2649010433 (4)gb:AY050778_15622879e-40Arabidopsis thaliana putative phosphatidate cytidylyltransferase (At2g45150) mRN
JMSF012N14Sequence196001895 (4)756010433 (4)gb:AY050778_15622877e-70Arabidopsis thaliana putative phosphatidate cytidylyltransferase (At2g45150) mRN

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012N14+ CCCTGTTTCTGGGTTAAGTTGAGATGCAGTTTAGCAGTGCCAGCCCT
rJMFF009H11+ CTGGGTTAAGTTGAGATGCAGTTTAGCAGTGCCAGCCNT
                      ____________________________________________________________
consensus CCCTGTTTCTGGGTTAAGTTGAGATGCAGTTTAGCAGTGCCAGCCCT
 
. : . : . : . : . : . :
rJMSF012N14+ ACATACACGAATAGCACAAGCCTGGCCAGTCTTATTAGGAGGCCAAACTCAATGGACGGT
rJMFF009H11+ ACATACACGAATAGCACAAGCCTGGCCAGTCTTATTAGGAGGCCAAACTCAATGGACGGT
                      ____________________________________________________________
consensus ACATACACGAATAGCACAAGCCTGGCCAGTCTTATTAGGAGGCCAAACTCAATGGACGGT
 
. : . : . : . : . : . :
rJMSF012N14+ GGGTCTTGTGGCATCCTTGATTTCTATTAGTAGTATCATTGCAGCAGACACATATGCTTT
rJMFF009H11+ GGGTCTTGTGGCATCCTTGATTTCTATTAGTAGTATCATTGCAGCAGACACATATGCTTT
                      ____________________________________________________________
consensus GGGTCTTGTGGCATCCTTGATTTCTATTAGTAGTATCATTGCAGCAGACACATATGCTTT
 
. : . : . : . : . : . :
rJMSF012N14+ TTTCGGCGGGAAGGTTTTTGGTAGGACACCGCTTACTGATATTAGTCCAAAGAAGACTTG
rJMFF009H11+ TTTCGGCGGGAAGGTTTTTGGTAGGACACCGCTTACTGATATTAGTCCAAAGAAGACTTG
rJMFF044H12+ GGAAGGTTTTTGGTAGGACACCGCTTACTGATATTAGTCCAAAGAAGACTTG
                      ____________________________________________________________
consensus TTTCGGCGGGAAGGTTTTTGGTAGGACACCGCTTACTGATATTAGTCCAAAGAAGACTTG
 
. : . : . : . : . : . :
rJMSF012N14+ GGAGGGAGCTCTGGCAGGTATTGGTGGTTGTATAGCCACTACTGTGGTATTGTCAAAGTT
rJMFF009H11+ GGAGGGAGCTCTGGCAGGTATTGGTGGTTGTATAGCCACTACTGTGGTATTGTCAAAGTT
rJMFF044H12+ GGAGGGAGCTCTGGCAGGTATTGGTGGTNGTATAGCCACTACTGTGGTATTGTCAAAGTT
                      ____________________________________________________________
consensus GGAGGGAGCTCTGGCAGGTATTGGTGGTTGTATAGCCACTACTGTGGTATTGTCAAAGTT
 
. : . : . : . : . : . :
rJMSF012N14+ ACTGAGCTGGCCTAGATCTATGCTAAGTGCTGTAGCTTTTGGAGTTTTGATCTTCTTTGG
rJMFF009H11+ ACTGAGCTGGCCTAGATCTATGCTAAGTGCTGTAGCTTTTGGAGTTTTGATCTTCTTTGG
rJMFF044H12+ ACTGAGCTGGCCTAGATCTATGCTAAGTGCTGTAGCTTTNGGAGTTTTGATCTTCTTTGG
                      ____________________________________________________________
consensus ACTGAGCTGGCCTAGATCTATGCTAAGTGCTGTAGCTTTTGGAGTTTTGATCTTCTTTGG
 
. : . : . : . : . : . :
rJMSF012N14+ ATCACTTTTTGGTGACCTCACCGAGTCCATGATCAAACGCGATGCTGGTGTGAAAGACTC
rJMFF009H11+ ATCACTTTTTGGTGACCTCACCGAGTCCATGATCAAACGCGATGCTGGTGTGAAAGACTC
rJMFF044H12+ ATCACTTTTTGGTGACCTCACCGAGTCCATGATCAAACGCGATGCTGGTGTGAAAGACTC
                      ____________________________________________________________
consensus ATCACTTTTTGGTGACCTCACCGAGTCCATGATCAAACGCGATGCTGGTGTGAAAGACTC
 
. : . : . : . : . : . :
rJMFF037P14+ GGGATCTCTCATCCCNGGACATGGNGGGGTACTGGACAGANTTNATAGCTACATATTCAC
rJMSF012N14+ GGGATCTCTCATCCCTGGACATGGTGGGGTACTGGACAGAGTTGATAGCTACATATTCAC
rJMFF009H11+ GGGATCTCTCATCCCTGGACATGGTGGGGTACTGGACAGAGTTGATAGCTACATATTCAC
rJMFF044H12+ GGGATCTCTCATCCCTGGACATGGTGGGGTACTGGACAGAGTTGATAGCTACATATTCAC
                      ____________________________________________________________
consensus GGGATCTCTCATCCCTGGACATGGTGGGGTACTGGACAGAGTTGATAGCTACATATTCAC
 
. : . : . : . : . : . :
rJMFF037P14+ AGGCGCCCTCGCNTATTCCNNNGTGAAAANGTTCGGTGCCCCTCTATGGCGTTTAATGAA
rJMSF012N14+ AGGCGCCCTCGCCTATTCCTTTGTGAAAATGTTC-CTGCCCCTCTATGGCGTTTAATGAA
rJMFF009H11+ AGGCGCCCTCGCCTATTCCTTTGTGAAAATGTTC-CTGCCCCTCTATGGCGTTTAATGAA
rJMFF044H12+ AGGCGCCCTCGCCTATTCCTTTGTGAAAATGTTC-CTGCCCCTCTATGGCGTTTAATGAA
                      ____________________________________________________________
consensus AGGCGCCCTCGCCTATTCCTTTGTGAAAATGTTC-CTGCCCCTCTATGGCGTTTAATGAA
 
. : . : . : . : . : . :
rJMFF037P14+ GCATCGAACCATACTCTTGGAAGGACACGCCCACCAATTTCTAGACACTGCATTCGGTGT
rJMSF012N14+ GCATCGAACCATACTCTTGGAAAGACACGCCCACCAATTTCTAGACACTGCATTCGGTGT
rJMFF009H11+ GCATCGAACCATACTCTTGGAAAGACACGCCCACCAATTTCTAGACACTGCATTCGGTGT
rJMFF044H12+ GCATCGAACCATACTCTTGGAAAGACACGCCCACCAATTTCTAGACACTGCATTCGGTGT
                      ____________________________________________________________
consensus GCATCGAACCATACTCTTGGAAAGACACGCCCACCAATTTCTAGACACTGCATTCGGTGT
 
. : . : . : . : . : . :
rJMFF037P14+ ATTAGCACCGAANATNGAGGTTTCTTNTGC-AAAAAACGCAAAAAGAATGA
rJMSF012N14+ ATTAGCACCGAATTTCGAGGTTTCTTCTGC-AAAAAACGCAAAAAGAATGATGTTTTTTG
rJMFF009H11+ ATTAGCACCGAATTTCGAGGTTTCTTCTGCAAAAAAACGCAAAAAGAATGATGTTTTTTG
rJMFF044H12+ ATTAGCACCGAATTTCGAGGTTTCTTCTGCAAAAAAACGCAAAAAGAATGATGTTTTTTG
                      ____________________________________________________________
consensus ATTAGCACCGAATTTCGAGGTTTCTTCTGCAAAAAAACGCAAAAAGAATGATGTTTTTTG
 
. : . : . : . : . : . :
rJMSF012N14+ CCAAGAGGAAACAGCGGGATAGGTTTATGAACTGATGTTCAGAGGTGCGTTGAGGTTGTC
rJMFF009H11+ CCAAGAGGAAACAGCGGGATAGGTTTATGAACTGATGTTCAGAGGTGCGTTGAGGTTGTC
rJMFF044H12+ CCAAGAGGAAACAGCGGGATAGGTTTATGAACTGATGTTCAGAGGTGCGTTGAGGTTGTC
                      ____________________________________________________________
consensus CCAAGAGGAAACAGCGGGATAGGTTTATGAACTGATGTTCAGAGGTGCGTTGAGGTTGTC
 
. : . : . : . : . : . :
rJMSF012N14+ TGTCTTTTCGCTTGCAATGCGACGATTCTGTTGTGTACAGGTGAGAGAGAT
rJMFF009H11+ TGTCTTTTCGCTTGCAATGCGACGA-TCTGTTGTGTACAGGTGAGAGAGATGCGAGAATT
rJMFF044H12+ TGTCTTTTCGCTTGCAATGCGACGA-TCTGTTGTGTACAGGTGAGAGAGATGC-AGAATT
                      ____________________________________________________________
consensus TGTCTTTTCGCTTGCAATGCGACGA-TCTGTTGTGTACAGGTGAGAGAGATGCGAGAATT
 
. : . : . : . : . : . :
rJMFF009H11+ CTNTAACTTA-TTTCTTCGTTCGAAAA
rJMFF044H12+ CTTTAACTTATTTTCTTCGTTCGAAAATCTGTACAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus CTTTAACTTATTTTCTTCGTTCGAAAATCTGTACAAAAAAAAAAAAAAACTCTCCAGGGT