Previous Contig 010426:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044H03Sequence628005508 (2)gb:ATU77366_15572704e-61Arabidopsis thaliana pasticcino 1-D (PAS1-D) mRNA, complete cds.595010426 (2)gb:AY056265_15635808e-16Arabidopsis thaliana putative pasticcino 1 protein (At3g54010) mRNA, complete cd
JMSF014O06Sequence457005508 (2)gb:AY056265_15635801e-27Arabidopsis thaliana putative pasticcino 1 protein (At3g54010) mRNA, complete cd799010426 (2)gb:AY056265_15635805e-55Arabidopsis thaliana putative pasticcino 1 protein (At3g54010) mRNA, complete cd

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF014O06+ CAGGGAANCGGCTTTTAAGGAAGGAAAGTTTGAACTTGCAAAGTCAAAGTATGAGAAGG
                      ____________________________________________________________
consensus CAGGGAANCGGCTTTTAAGGAAGGAAAGTTTGAACTTGCAAAGTCAAAGTATGAGAAGG
 
. : . : . : . : . : . :
rJMSF014O06+ TTCTTCGTGAATTTAATCATGTTAATCCTCAAGATGATGAAGAGGGAAAGGAATTCTCTG
                      ____________________________________________________________
consensus TTCTTCGTGAATTTAATCATGTTAATCCTCAAGATGATGAAGAGGGAAAGGAATTCTCTG
 
. : . : . : . : . : . :
rJMSF014O06+ AAACCAGGAATTTGTTGCATCTTAATGTTGCTGCCTGCTATCTGAAGATGGGAGAGCACA
                      ____________________________________________________________
consensus AAACCAGGAATTTGTTGCATCTTAATGTTGCTGCCTGCTATCTGAAGATGGGAGAGCACA
 
. : . : . : . : . : . :
rJMSF014O06+ GAAAGTCAATAGAGGCATGTAATAAGGTGTTAGATGCGAATCCTGTTCATGTCAAAGCAT
                      ____________________________________________________________
consensus GAAAGTCAATAGAGGCATGTAATAAGGTGTTAGATGCGAATCCTGTTCATGTCAAAGCAT
 
. : . : . : . : . : . :
rJMSF014O06+ TTTATCGACGTGGAATGGCTTACATGGCGGGTGGAGATTTTGAGGAAGCAAGGGATGATT
rJMFF044H03+ CGACGTGGAATGGCTTACATGGCGGGTGGAGATTTTGAGGAAGCAAGGGATGGTT
                      ____________________________________________________________
consensus TTTATCGACGTGGAATGGCTTACATGGCGGGTGGAGATTTTGAGGAAGCAAGGGATGGTT
 
. : . : . : . : . : . :
rJMSF014O06+ TTAACAAGATGATGAGCATTGACAAGTCATCTGAGACAACAGCGAAGGCAGCTCTCATGA
rJMFF044H03+ TTAACAAGATGATGAGCATTGACAAGTCATCTGAGACAACAGCGAAGGCAGCTCTCATGA
                      ____________________________________________________________
consensus TTAACAAGATGATGAGCATTGACAAGTCATCTGAGACAACAGCGAAGGCAGCTCTCATGA
 
. : . : . : . : . : . :
rJMSF014O06+ AACTAAAAAAGGAGGAACAGGAAGTCCACAAGAGAGCTCGTAAGCAATTTAAAGGGCTGT
rJMFF044H03+ AACTAAAAAAGGAGGAACAGGAAGTCCACAAGAGAGCTCGTAAGCAATTTAAAGGGCTGT
                      ____________________________________________________________
consensus AACTAAAAAAGGAGGAACAGGAAGTCCACAAGAGAGCTCGTAAGCAATTTAAAGGGCTGT
 
. : . : . : . : . : . :
rJMSF014O06+ TTGACAAAAGACCTGGAGAAATCGCAGAAGTTGATACCAGTGAAACAGGTGCCATGGATG
rJMFF044H03+ TTGACAAAAGACCTGGAGAAATCGCAGAAGTTGATACCAGTGAAACAGGTGCCATGGATG
                      ____________________________________________________________
consensus TTGACAAAAGACCTGGAGAAATCGCAGAAGTTGATACCAGTGAAACAGGTGCCATGGATG
 
. : . : . : . : . : . :
rJMSF014O06+ CAAGTGAAAATGACGAAGACAACAATGAAACCAGAGGCTTACTTACAACTGAAGATAGTA
rJMFF044H03+ CAAGTGAAAATGACGAAGACAACAATGAAACCAGAGGCTTACTTACAACTGAAGATAGTA
                      ____________________________________________________________
consensus CAAGTGAAAATGACGAAGACAACAATGAAACCAGAGGCTTACTTACAACTGAAGATAGTA
 
. : . : . : . : . : . :
rJMSF014O06+ TGAATGAGACTGAAGCGGTTCCCCCTAGCACGGGTATTTTGTCCAAGCTTAGAAGACTGT
rJMFF044H03+ TGAATGAGACTGAAGCGGTTCCCCCTAGCACGGGTATTTTGTCCAAGCTTAGAAGACTGT
                      ____________________________________________________________
consensus TGAATGAGACTGAAGCGGTTCCCCCTAGCACGGGTATTTTGTCCAAGCTTAGAAGACTGT
 
. : . : . : . : . : . :
rJMSF014O06+ TTGCATCTATTGGCCTAAACAGATGTGCCATATTGTGAGTGTGGGTTCTGGGCAGCTGAA
rJMFF044H03+ TTGCATCTATTGGCCTAAACAGATGTGCCATATTGTGAGTGTGGGTTCTGGGCAGCTGAA
                      ____________________________________________________________
consensus TTGCATCTATTGGCCTAAACAGATGTGCCATATTGTGAGTGTGGGTTCTGGGCAGCTGAA
 
. : . : . : . : . : . :
rJMSF014O06+ TTATATTGCCCTTGTTATGACTACTCCTCAACACGTCAAAGTGCGTGGGTAGTTTTCTAC
rJMFF044H03+ TTATATTGCCCTTGTTATGACTACTCCTCAACACGTCAAAGTGCGTGGGTAGTTTTCTAC
                      ____________________________________________________________
consensus TTATATTGCCCTTGTTATGACTACTCCTCAACACGTCAAAGTGCGTGGGTAGTTTTCTAC
 
. : . : . : . : . : . :
rJMSF014O06+ TTTTCTGTCACCATTCATGGTGAAAAAAGCTCGAGTCTGTAAACTCACGCACTACCTTTT
rJMFF044H03+ TTTTCTGTCACCATTCATGGTGAAAAAAGCTCGAGTCTGTAAACTCACGCACTACCTTTT
                      ____________________________________________________________
consensus TTTTCTGTCACCATTCATGGTGAAAAAAGCTCGAGTCTGTAAACTCACGCACTACCTTTT
 
. : . : . : . : . : . :
rJMSF014O06+ TTGAACCAATGAAACCTGGA
rJMFF044H03+ TTGAACCAATGAAACTTGGAAAATACAGATCGAATAACAGAAAAAACTCAAATTATATGC
                      ____________________________________________________________
consensus TTGAACCAATGAAACTTGGAAAATACAGATCGAATAACAGAAAAAACTCAAATTATATGC