Previous Contig 010421:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044G03Sequence624010421 (7)gb:AF325048_17865025e-41Arabidopsis thaliana AT4g27650 (AT4g27650/T29A15_140) mRNA, complete cds.641010421 (7)gb:AF480497_18037665e-31Oryza sativa clone BAC 24K23, complete sequence.
JMSF003I03Sequence244004223 (6)740010421 (7)pir|T05870|T058701e-46cell division protein pelota - Arabidopsis thaliana>gb:ATCHRIV67_1546646 Arabido
JMSF003L24Sequence296004223 (6)735010421 (7)pir|T05870|T058701e-27cell division protein pelota - Arabidopsis thaliana>gb:ATCHRIV67_1546646 Arabido
JMSF004L24Sequence372004223 (6)338010421 (7)
JMSF044N09Sequence811004223 (6)gb:AC073178_15410093e-04Arabidopsis thaliana chromosome 1 BAC F10D13 genomic sequence, complete sequence674010421 (7)pir|T05870|T058703e-59cell division protein pelota - Arabidopsis thaliana>gb:ATCHRIV67_1546646 Arabido
JMSF051H13Sequence710004223 (6)gb:AC073178_15410093e-04Arabidopsis thaliana chromosome 1 BAC F10D13 genomic sequence, complete sequence754010421 (7)pir|T05870|T058703e-45cell division protein pelota - Arabidopsis thaliana>gb:ATCHRIV67_1546646 Arabido

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044G03- GACTATTTGTCTATCTCTCATTCTCTCCCGTGTCTCAGCCTCCCAGCCTCAC
                      ____________________________________________________________
consensus GACTATTTGTCTATCTCTCATTCTCTCCCGTGTCTCAGCCTCCCAGCCTCAC
 
. : . : . : . : . : . :
JMFF044G03- GAGTCACGCCGTCGTCCACTCACCGTCCGGCCATCCCAGACTCCCTCATCGTCAGTCCGT
                      ____________________________________________________________
consensus GAGTCACGCCGTCGTCCACTCACCGTCCGGCCATCCCAGACTCCCTCATCGTCAGTCCGT
 
. : . : . : . : . : . :
JMFF044G03- CACCATCCCAGACTCCCAGTCTGTCTCTGCCGGCTGCGGCTCTGCCTCTCCGCCGTCTCT
                      ____________________________________________________________
consensus CACCATCCCAGACTCCCAGTCTGTCTCTGCCGGCTGCGGCTCTGCCTCTCCGCCGTCTCT
 
. : . : . : . : . : . :
JMFF044G03- ACCTCCCTGGTCGTCCCCATCTCTGCCTCTCTTGTCGGCTGCGACTCATCCCAGTCTGCT
                      ____________________________________________________________
consensus ACCTCCCTGGTCGTCCCCATCTCTGCCTCTCTTGTCGGCTGCGACTCATCCCAGTCTGCT
 
. : . : . : . : . : . :
JMFF044G03- GTCACCGGCTGCTGCTCTGCGACTCTGCCAGATATCCAGTAAAATCGTAAAACATGAAGA
                      ____________________________________________________________
consensus GTCACCGGCTGCTGCTCTGCGACTCTGCCAGATATCCAGTAAAATCGTAAAACATGAAGA
 
. : . : . : . : . : . :
JMFF044G03- TTGTTCGCAGAGACCTCATCCCCAAAGGCCCCGGCAGCGTCAAGATGGTTGCTGAAGAAG
                      ____________________________________________________________
consensus TTGTTCGCAGAGACCTCATCCCCAAAGGCCCCGGCAGCGTCAAGATGGTTGCTGAAGAAG
 
. : . : . : . : . : . :
JMFF044G03- CAGATGATTTGTGGATTGCCTATAATTTGATAGGCGAGGGTGACACTGTTTTAGCTTCTA
                      ____________________________________________________________
consensus CAGATGATTTGTGGATTGCCTATAATTTGATAGGCGAGGGTGACACTGTTTTAGCTTCTA
 
. : . : . : . : . : . :
JMFF044G03- CTTTTAGGAAAGTTTTAAGGGAAGATGCCTCGGGAGGAAGAGAAGCAGAACGACTAANAT
                      ____________________________________________________________
consensus CTTTTAGGAAAGTTTTAAGGGAAGATGCCTCGGGAGGAAGAGAAGCAGAACGACTAANAT
 
. : . : . : . : . : . :
JMFF044G03- TAAAATTACAGATAAAAGTTGAGGCTGTGGAGTATGATAAAGAAGATTCTACCTTGCGTA
                      ____________________________________________________________
consensus TAAAATTACAGATAAAAGTTGAGGCTGTGGAGTATGATAAAGAAGATTCTACCTTGCGTA
 
. : . : . : . : . : . :
JMFF044G03- TACGTGGGAAGAACATCCTGGAGAATGAACATGTAAAGATTGGTGCATTTCACACACTAG
rJMSF044N09+ ATTGGTGCATTTCACACACTAG
                      ____________________________________________________________
consensus TACGTGGGAAGAACATCCTGGAGAATGAACATGTAAAGATTGGTGCATTTCACACACTAG
 
. : . : . : . : . : . :
JMFF044G03- AAATTGAGCTTCACAGACCTTTCGTTTTGGGG
rJMSF044N09+ AAGTTGAGCTTCACAGACCTTTCGTTTTGGGGAAGGATGTCTGGGACTCACTTGCTTTGG
rJMSF003I03+ TGGGACTCACTTGC-TTGG
                      ____________________________________________________________
consensus AAGTTGAGCTTCACAGACCTTTCGTTTTGGGGAAGGATGTCTGGGACTCACTTGCTTTGG
 
. : . : . : . : . : . :
rJMSF044N09+ AGGCTCTTCGTCAAGCTGCTGATCCTGCTGCAAGTGCTGACCTGGCTGTGGTTTTGATGC
rJMSF003I03+ AGGCTCTTCGTCAAGCTGCTGATCCTGCTGCAAGTGCTGACCTGGCTGTGGTTTTGATGC
rJMSF051H13+ GTCAAGCTGCTGATCCTGCTGCAAGTGCTGACCTGGCTGTGGTTTTGATGC
                      ____________________________________________________________
consensus AGGCTCTTCGTCAAGCTGCTGATCCTGCTGCAAGTGCTGACCTGGCTGTGGTTTTGATGC
 
. : . : . : . : . : . :
rJMSF044N09+ AAGAGGGCTCGGCACAGATTTTTCTAATTGGTAAAAGTGTAACAATTTCTCGTTCTCGGA
rJMSF003I03+ AAGAGGGCTCGGCACAGATTTTTCTAATTGGTAAAAGTGTAACAATTTCTCGTTCTCGGA
rJMSF051H13+ AAGAGGGCTCGGCACAGATTTTTCTAATTGGTAAAAGTGTAACAATTTCTCGTTCTCGGA
                      ____________________________________________________________
consensus AAGAGGGCTCGGCACAGATTTTTCTAATTGGTAAAAGTGTAACAATTTCTCGTTCTCGGA
 
. : . : . : . : . : . :
rJMSF044N09+ TAGAGACTTCTATTCCTTGGAAGCATGGCCCTGCTATAGCTGGTTATGATAAAGCTCTGA
rJMSF003I03+ TAGAGACTTCTATTCCTTGGAAGCATGGCCCTGCTATAGCTGGTTATGATAAAGCTCTGA
rJMSF051H13+ TAGAGACTTCTATTCCTTGGAAGCATGGCCCTGCTATAGCTGGTTATGATAAAGCTCTGA
                      ____________________________________________________________
consensus TAGAGACTTCTATTCCTTGGAAGCATGGCCCTGCTATAGCTGGTTATGATAAAGCTCTGA
 
. : . : . : . : . : . :
rJMSF044N09+ CTAAGTTCTTCAATAATGTTGTAGATGCTTTCCTTAAGCATATTGATTTCAACGTGATTC
rJMSF003I03+ CTAAGTTCTTCAATAATGTTGTAGATGCTTTCCTTAAGCATATTGATTTCAACGTGATTC
rJMSF003L24+ GCTTTCCTTAAGCATATTGATTTCAACGTGATTC
rJMSF051H13+ CTAAGTTCTTCAATAATGTTGTAGATGCTTTCCTTAAGCATATTGATTTCAACGTGATTC
                      ____________________________________________________________
consensus CTAAGTTCTTCAATAATGTTGTAGATGCTTTCCTTAAGCATATTGATTTCAACGTGATTC
 
. : . : . : . : . : . :
rJMSF044N09+ GTTGTGCTGTGATTGCAAGTCCAGGATTCACAAAGGATCAATTTCATCGTCACTTGCTGT
rJMSF003I03+ GTTGTGCTGTGATTGCAAGTCCAGGATTCACAAAGGATCAATTTCATCGTCACTTGCTGT
rJMSF003L24+ GTTGTGCTGTGATTGCAAGTCCAGGATTCACAAAGGATCAATTTCATCGTCACTTGCTGT
rJMSF051H13+ GTTGTGCTGTGATTGCAAGTCCAGGATTCACAAAGGATCAATTTCATCGTCACTTGCTGT
                      ____________________________________________________________
consensus GTTGTGCTGTGATTGCAAGTCCAGGATTCACAAAGGATCAATTTCATCGTCACTTGCTGT
 
. : . : . : . : . : . :
rJMSF044N09+ TAGAAGCAGAGAGGAAGCAACTGAGACCTATAATAGAGAACAAATCACGGATAATTCTTG
rJMSF003I03+ TAGAAGCAGAGAGGAAGCAACTGAGACCTATAATAGAGAACAAATCACGGATAATTCTTG
rJMSF003L24+ TAGAAGCAGAGAGGAAGCAACTGAGACCTATAATAGAGAACAAATCACGGATAATTCTTG
rJMSF051H13+ TAGAAGCAGAGAGGAAGCAACTGAGACCTATAATAGAGAACAAATCACGGATAATTCTTG
                      ____________________________________________________________
consensus TAGAAGCAGAGAGGAAGCAACTGAGACCTATAATAGAGAACAAATCACGGATAATTCTTG
 
. : . : . : . : . : . :
rJMSF044N09+ CACATACTACCTTGGGATATAAAACTGACGATGATGAGTGGTATTGCTGCAATCCTTCGG
rJMSF003I03+ CACATACTACCTTGGGATATAAAACTGACGATGATGAGTGGTATTGCTGCAATCCTTCGG
rJMSF003L24+ CACATACTACCTTGGGATATAAAACTGACGATGATGAGTGGTATTGCTGCAATCCTTCGG
rJMSF051H13+ CACATACTACCTTGGGATATAAAACTGACGATGATGAGTGGTATTGCTGCAATCCTTCGG
rJMFF044G03+ AACTGACGATGATGAGTGGTATTGCTGCAATCCTTCGG
                      ____________________________________________________________
consensus CACATACTACCTTGGGATATAAAACTGACGATGATGAGTGGTATTGCTGCAATCCTTCGG
 
. : . : . : . : . : . :
rJMSF044N09+ TTTCCATTGCCCGACCTTGATGACATAGAGATGTGATGGAATGGAGGAAGGAATGCTTAA
rJMSF003I03+ TTTCCATTGCCCGACCTTGATGACATAGAGATGTGATGGAATGGAGGAAGGAATGCTTAA
rJMSF003L24+ TTTCCATTGCCCGACCTTGATGACATAGAGATGTGATGGAATGGAGGAAGGAATGCTTAA
rJMSF051H13+ TTTCCATTGCCCGACCTTGATGACATAGAGATGTGATGGAATGGAGGAAGGAATGCTTAA
rJMSF004L24+ CATTGCCCGACCTTGATGACATAGAGATGTGATGGAATGGAGGAAGGAATGCTTAA
rJMFF044G03+ TTTCCATTGCCCGACCTAGATGACATAGAAATGTGATGGAATGGAGGAAGGAGTGCTTAA
                      ____________________________________________________________
consensus TTTCCATTGCCCGACCTTGATGACATAGAGATGTGATGGAATGGAGGAAGGAATGCTTAA
 
. : . : . : . : . : . :
rJMSF044N09+ TCACATTATTCTGTCTTCATTACATTGATGTGAGATTCCTCAAAGAGAGCTTAGTAGGTG
rJMSF003I03+ TCACATTATTCTGTCTTCATTACATTGATGTGAGATTCCTCAAAGAGAGCTTAGTAGGTG
rJMSF003L24+ TCACATTATTCTGTCTTCATTACATTGATGTGAGATTCCTCAAAGAGAGCTTAGTAGGTG
rJMSF051H13+ TCACATTATTCTGTCTTCATTACATTGATGTGAGATTCCTCAAAGAGAGCTTAGTAGGTG
rJMSF004L24+ TCACATTATTCTGTCTTCATTACATTGATGTGAGATTCCTCAAAGAGAGCTTAGTAGGTG
rJMFF044G03+ TCACATTATTCTGTCTCCATTACATTGATGTGAGATTCCTCAAAGAGAGCTTAGTAGGTG
                      ____________________________________________________________
consensus TCACATTATTCTGTCTTCATTACATTGATGTGAGATTCCTCAAAGAGAGCTTAGTAGGTG
 
. : . : . : . : . : . :
rJMSF044N09+ ATGGTTGAATACATATACTTCCCATTCGCCTTGTATTACAAAATGGATTACT
rJMSF003I03+ ATGGTTGAATACATATACTTCCCATTCGCCTTGTATTACAAAATGGATTACTTGTATTGT
rJMSF003L24+ ATGGTTGAATACATATACTTCCCATTCGCCTTGTATTACAAAATGGATTACTTGTATTGT
rJMSF051H13+ ATGGTTGAATACATATACTTCCCATTCGCCTTGTATTACAAAATGGATTACTTGTATTGT
rJMSF004L24+ ATGGTTGAATACATATACTTCCCATTCGCCTTGTATTACAAAATGGATTACTTGTATTGT
rJMFF044G03+ ATGGTTGAATACATATACTTCCCATTCGCCTTATATTACAAAATGGATTACTTGTATTGT
                      ____________________________________________________________
consensus ATGGTTGAATACATATACTTCCCATTCGCCTTGTATTACAAAATGGATTACTTGTATTGT
 
. : . : . : . : . : . :
rJMSF003I03+ ACTCTATGTATATAGTCTTCACAAGAACAGAGCTATCTTC-----TTCATAAGCAAATGG
rJMSF003L24+ ACTCTATGTATATAGTCTTCACAAGAACAGAGCTATCTTC-----TTCATAAGCAAATGG
rJMSF051H13+ ACTCTATGTATATAGTCTTCACAAGAACAGAGCTATCTTC-----TTCATAAGCAAATGG
rJMSF004L24+ ACTCTATGTATATAGTCTTCACAAGAACAGAGCTATCTTC-----TTCATAAGCAAATGG
rJMFF044G03+ ACTCTATGTATATAGTCTTCACAAGAACAGAGCTATCTTCTTCAATTCATAAGCAAATGG
                      ____________________________________________________________
consensus ACTCTATGTATATAGTCTTCACAAGAACAGAGCTATCTTC-----TTCATAAGCAAATGG
 
. : . : . : . : . : . :
rJMSF003I03+ GATTTGGGTATTTGATATACCGCGTCATTTGGCATC-----TCACTCAAATGGAATAATA
rJMSF003L24+ GATTTGGGTATTTGATATACCGCGTCATTTGGCATC-----TCACTCAAATGGAATAATA
rJMSF051H13+ GATTTGGGTATTTGATATACCGCGTCATTTGGCATC-----TCACTCAAATGGAATAATA
rJMSF004L24+ GATTTGGGTATTTGATATACCGCGTCATTTGGCATC-----TCACTCAAATGGAATAATA
rJMFF044G03+ GATTTGGGTATTTGATATACCGCGTCATTTGGCATCTCAGATCACTCAAATGGAATAATA
                      ____________________________________________________________
consensus GATTTGGGTATTTGATATACCGCGTCATTTGGCATC-----TCACTCAAATGGAATAATA
 
. : . : . : . : . : . :
rJMSF003I03+ TTTCTGTCACAT
rJMSF003L24+ TTTCTGTCACATTTTTTAAAAGTTTAGTGTAGGTGAAGACACCATCACATTT
rJMSF051H13+ TTTCTGTCACATTTTTTAAAAGTTTAGTGTAGGTGAAGACACCATCACATTT
rJMSF004L24+ TTTCTGTCACATTTTNTAAAAGTTTAGTGTAGG-GAAGACACCATCACATTT
rJMFF044G03+ TTTCTGTCACATTTTTTAAAAGTTTAGTGTAGGTGAAGACACCATCACATTTTGTAGATG
                      ____________________________________________________________
consensus TTTCTGTCACATTTTTTAAAAGTTTAGTGTAGGTGAAGACACCATCACATTTTGTAGATG
 
. : . : . : . : . : . :
rJMFF044G03+ TGCTTTTAGTTTGAATAAAAGTATTTTTTTAAGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TGCTTTTAGTTTGAATAAAAGTATTTTTTTAAGAAAAAAAAAAAAAAAACTCTCCAGGGT