Previous Contig 010416:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C23Sequence526001656 (10)gb:AY099822_15768471e-12Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT733010416 (11)pir|T49310|T493101e-30hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMFF009N16Sequence482001656 (10)gb:AY099822_15768473e-13Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT704010416 (11)pir|T49310|T493102e-30hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMFF015M04Sequence129010416 (11)gb:AF531372_18093130.041Gossypium barbadense fiber protein Fb13 mRNA, partial cds.
JMFF018M05Sequence510001656 (10)gb:AY099822_15768473e-13Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT812010416 (11)pir|T49310|T493101e-31hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMFF019P22Sequence469001656 (10)gb:AY099822_15768472e-13Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT718010416 (11)pir|T49310|T493109e-32hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMFF029E06Sequence554001656 (10)pir|T49310|T493104e-20hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi621010416 (11)pir|T49310|T493107e-29hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMFF037G14Sequence759010416 (11)pir|T49310|T493109e-32hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMFF038F18Sequence538001656 (10)gb:AY099822_15768471e-12Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT729010416 (11)pir|T49310|T493109e-32hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMFF041K04Sequence621001656 (10)gb:AY099822_15768477e-15Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT604010416 (11)pir|T49310|T493102e-25hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMFF044F07Sequence637001656 (10)gb:AY099822_15768471e-15Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT635010416 (11)pir|T49310|T493103e-25hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi
JMSF031P24Sequence718001656 (10)gb:AY099822_15768477e-13Arabidopsis thaliana putative SF16 protein (At2g43680) mRNA, complete cds.>gb:BT639010416 (11)pir|T49310|T493107e-32hypothetical protein T16L24.240 - Arabidopsis thaliana>gb:ATT16L24_1554659 Arabi

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF003C23+ GTCC
rJMSF031P24+ GTGAAAAATGTCC
rJMFF018M05+ AGAAAGCCCGTNTGCTGTGAAAAATGTCC
                      ____________________________________________________________
consensus AGAAAGCCCGTNTGCTGTGAAAAATGTCC
 
. : . : . : . : . : . :
rJMFF037G14+ AGACCGTAAAAAAGGGAGCCCTTTACTCCAAACTC
rJMFF038F18+ AAAGGGAGCCCTTTACTCCAAACT-
rJMFF003C23+ CCCGAACACCTTCAAGTGCAATTTCAGACCGTAAAAAAGGGAGCCCTTTACTCCAAACT-
rJMFF019P22+ CTTCAAGTGCAATTTCAGACCGTAAAAAAGGGAGCCCTTTACTCCAAACT-
rJMSF031P24+ CCCGAACACCTTCNAGTGCAATTTCAGACCGTAAAAAAGGGAGCCCTTTACTCAAAACTC
rJMFF018M05+ CCCGANCACCTTCAAGTGCAATTTCAGACNGTAAAAAAGGGAGCCCTTTACTCCAAACT-
                      ____________________________________________________________
consensus CCCGAACACCTTCAAGTGCAATTTCAGACCGTAAAAAAGGGAGCCCTTTACTCCAAACT-
 
. : . : . : . : . : . :
rJMFF037G14+ CCCAACTATAGATACCCAAGTAGCGAATATGACAATCTTGAATCGGAGACT-CCAACATC
rJMFF038F18+ CCCAACTATAGATACCCAAGTAGCGAATATGACAATCTTGAATCGGAGACT-CCAACATC
rJMFF003C23+ CCCAACTATAGATACCCAAGTAGCGAATATGACAATCTTGAATCGGAGACT-CCAACATC
rJMFF019P22+ CCCAACTATAGATACCCAAGTAGCGAATATGACAATCTTGAATCGGAGACT-CCAACATC
rJMSF031P24+ CCCAACTATAGATACCCAAGTAGCGAATATGACAATCTTGAATCGGAGACT-CCAACATC
rJMFF018M05+ CCCAACTATAGATACCCAAGTAGCGAATATGACAATCTTGAATCGGAGACT-CCAACATC
rJMFF009N16+ GAATCGGAGACTCCCAACATC
                      ____________________________________________________________
consensus CCCAACTATAGATACCCAAGTAGCGAATATGACAATCTTGAATCGGAGACT-CCAACATC
 
. : . : . : . : . : . :
rJMFF037G14+ AACAAAGTCGGCGATCCCAATGAGAGCGAGACCATTTCATACTCCCGGGAGAACGCCTCC
rJMFF038F18+ AACAAAGTCGGCGATCCCAATGAGAGCGAGACCATTTCATACTCCCGGGAGAACGCCTCC
rJMFF003C23+ AACAAAGTCGGCGATCCCAATGAGAGCGAGACCATTTCATACTCCCGGGAGAACGCCTCC
rJMFF019P22+ AACAAAGTCGGCGATCCCAATGAGAGCGAGACCATTTCATACTCCCGGGAGAACGCCTCC
rJMFF029E06+ CCAATGAGAGCGAGACCATTTCATACTCCCGGGAGAACGCCTCC
rJMSF031P24+ AACAAAGTCGGCGATCCCAATGAGAGCGAGACCATTTCATACTCCCGGGAGAACGCCTCC
rJMFF018M05+ AACAAAGTCGGCGATCCCAATGAGAGCGAGACCATTTCATACTCCCGGGAGAACGCCTCC
rJMFF009N16+ AACAAAGTCGGCGATCCCAATGAGAGCGAGACCATTTCATACTCCCGGGAGAACGCCTCC
                      ____________________________________________________________
consensus AACAAAGTCGGCGATCCCAATGAGAGCGAGACCATTTCATACTCCCGGGAGAACGCCTCC
 
. : . : . : . : . : . :
rJMFF037G14+ AAATTCAATCCTAAGAAAGTACACTCGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
rJMFF038F18+ AAATTCAATCCTAAGAAAGTACACTCGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
rJMFF003C23+ AAATTCAATCCTAAGAAAGTACACTCGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
rJMFF019P22+ AAATTCAATCCTAAGAAAGTACACTCGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
rJMFF029E06+ AAATTCAATCCTGAGAAAGTACACTCGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
rJMSF031P24+ AAATTCAATCCTAAGAAAGTACACTCGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
rJMFF018M05+ AAATTCAATCCTAAGAAAGTACACTCGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
rJMFF009N16+ AAATTCAATCNTAAGAAAGTACACTCGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
rJMFF041K04+ CCCGATCCAATGCTACTGGATCGCCTTTCCA
rJMFF044F07+ CGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
                      ____________________________________________________________
consensus AAATTCAATCCTAAGAAAGTACACTCGTGCCCGATCCAATGCTACTGGATCGCCTTTCCA
 
. : . : . : . : . : . :
rJMFF037G14+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
rJMFF038F18+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
rJMFF003C23+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
rJMFF019P22+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
rJMFF029E06+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
rJMSF031P24+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
rJMFF018M05+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
rJMFF009N16+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
rJMFF041K04+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
rJMFF044F07+ GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
                      ____________________________________________________________
consensus GTTCCCGTTGAAGGATGATGACAGCCTAACAAGCTGCCCTCCGTTTTCCGCTCCGAGTTA
 
. : . : . : . : . : . :
rJMFF037G14+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
rJMFF038F18+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
rJMFF003C23+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
rJMFF019P22+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
rJMFF029E06+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
rJMSF031P24+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
rJMFF018M05+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
rJMFF009N16+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
rJMFF041K04+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
rJMFF044F07+ CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
                      ____________________________________________________________
consensus CATGGCACCTACCATCTCAGCTAAAGCGAAAGCGAGGCCAAATGCCAATCCGAGGGAAGG
 
. : . : . : . : . : . :
rJMFF037G14+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
rJMFF038F18+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
rJMFF003C23+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
rJMFF019P22+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
rJMFF029E06+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
rJMSF031P24+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
rJMFF018M05+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
rJMFF009N16+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
rJMFF041K04+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
rJMFF044F07+ GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
                      ____________________________________________________________
consensus GGAGTTTGGGACCCCGTCTAGTGGCGCAGCGAGGAGGTTAACCTTTCCTTTTACTCCAAA
 
. : . : . : . : . : . :
rJMFF037G14+ TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
rJMFF038F18+ TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
rJMFF003C23+ TATCGTGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
rJMFF019P22+ TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
rJMFF029E06+ TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
rJMSF031P24+ TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
rJMFF018M05+ TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
rJMFF009N16+ TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
rJMFF041K04+ TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
rJMFF044F07+ TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
                      ____________________________________________________________
consensus TATCGGGTCTTTCAAGTGGAACAAAGGGTCCAACAAAGATGCTGCATCTCTACGGGAATT
 
. : . : . : . : . : . :
rJMFF037G14+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
rJMFF038F18+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
rJMFF015M04+ GACAGGAGCGCGGATGGGATGAGTGNGGATTCCANTGTTTCTATGCCAGCTATAGTTGG
rJMFF003C23+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
rJMFF019P22+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
rJMFF029E06+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
rJMSF031P24+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
rJMFF018M05+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
rJMFF009N16+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
rJMFF041K04+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
rJMFF044F07+ TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
                      ____________________________________________________________
consensus TGACAGGAGCGCGGATGGGATGAGTGTGGATTCCACTGTTTCTATGCCAGCTATAGTTGG
 
. : . : . : . : . : . :
rJMFF037G14+ TAGGAAGCCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
rJMFF038F18+ TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
rJMFF015M04+ TAGGAAACCTTTTAACAGATNNGTGTGATTCGATTTCTTGAATGTTTTTNTGTGTCGTCG
rJMFF003C23+ TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
rJMFF019P22+ TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
rJMFF029E06+ TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
rJMSF031P24+ TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
rJMFF018M05+ TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
rJMFF009N16+ TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
rJMFF041K04+ TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
rJMFF044F07+ TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
                      ____________________________________________________________
consensus TAGGAAACCTTTTAACAGATTTGTGTGATTCGATTTCTTGAATGTTTTTCTGTGTTGTCG
 
. : . : . : . : . : . :
rJMFF037G14+ ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
rJMFF038F18+ ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
rJMFF015M04+ ACGTTT
rJMFF003C23+ ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
rJMFF019P22+ ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
rJMFF029E06+ ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
rJMSF031P24+ ACGTTTGTAGCGTTAACCT
rJMFF018M05+ ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
rJMFF009N16+ ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
rJMFF041K04+ ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
rJMFF044F07+ ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
                      ____________________________________________________________
consensus ACGTTTGTAGCGTTAACCTTGGAATTTGCTAGTGTCTTTGTATGTATGGTGATATGTTGA
 
. : . : . : . : . : . :
rJMFF037G14+ TTCCCAAATACTAATATGCACAATAATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
rJMFF038F18+ TTCCCAAATACTAATATGCACAATAATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
rJMFF003C23+ TTCCCAAATACTAATATGCACAATAATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
rJMFF019P22+ TTCCCAAATACTAATATGCACAATAATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
rJMFF029E06+ TTCCCAAATACTAATATGCACAATAATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
rJMFF018M05+ TTCCCAAATACTAATATGCACAATAATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
rJMFF009N16+ TTCCCAAATACTAATATGCACAATTATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
rJMFF041K04+ TTCCCAAATACTAATATGCACAATAATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
rJMFF044F07+ TTCCCAAATACTAATATGCACAATAATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
                      ____________________________________________________________
consensus TTCCCAAATACTAATATGCACAATAATGGTAGAGTAGGGAATGTTCTGAGTGTAGTTGAA
 
. : . : . : . : . : . :
rJMFF037G14+ TATTTATAAAAGTTGTAGTGTGCATATTCTGTAACTTTTGTCTTTGGATCAATGTGTAAG
rJMFF038F18+ TATTTATAAAAGTTGTAGTGTGCATATTCTGTAACTTTTGTCTTTG
rJMFF003C23+ TATT
rJMFF019P22+ TATTTATAA
rJMFF029E06+ TATTTATAAAAGTTGTAGTGTGCATATTCNGTAACTT
rJMFF018M05+ TATTTATAAAAGTTGTAGTGTGCATATTCTGTAACTTTTGTCTTTGGATCAATGTGTAAG
rJMFF009N16+ TATTTATAAAAGTTGTAGTGTGCATATTCTGTAACTTTTGTCTTTGGATCAATGTGTAAG
rJMFF041K04+ TATTTATAAAAGTTGTAGTGTGCATATTCTGTAACTTTTGTCTTTGGATCAATGTGTAAG
rJMFF044F07+ TATTTATAAAAGTTGTAGTGTGCATATTCTGTAACTTTTGTCTTTGGATCAATGTGTAAG
                      ____________________________________________________________
consensus TATTTATAAAAGTTGTAGTGTGCATATTCTGTAACTTTTGTCTTTGGATCAATGTGTAAG
 
. : . : . : . : . : . :
rJMFF037G14+ TCAGC
rJMFF018M05+ TCAGC
rJMFF009N16+ TCAGCTTCTATTGTGGCTGTAA
rJMFF041K04+ TCAGCTTCTATTGTGGCTGTAAAAAAAAAAAAG
rJMFF044F07+ TCAGCTTCTATTGTGGCTGTAAAAAAAAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TCAGCTTCTATTGTGGCTGTAAAAAAAAAAAAGAAAAAAAAAAAAAAAACTCTCCAGGGT