Previous Contig 010414:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006J05Sequence533010793 (25)pir|S52018|S520189e-68translation initiation factor eIF-4A.11 - common tobacco547010414 (7)sp|P41379|IF42_NICPL6e-25Eukaryotic initiation factor 4A-2 (eIF4A-2) (eIF-4A-2).>pir|S22578|S22578 transl
JMFF022C07Sequence502010793 (25)pir|S52018|S520184e-54translation initiation factor eIF-4A.11 - common tobacco385010414 (7)gb:AF079782_17664068e-04Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF025G08Sequence547010793 (25)pir|S52018|S520182e-72translation initiation factor eIF-4A.11 - common tobacco433010414 (7)sp|P41379|IF42_NICPL2e-09Eukaryotic initiation factor 4A-2 (eIF4A-2) (eIF-4A-2).>pir|S22578|S22578 transl
JMFF037K15Sequence592010793 (25)pir|S52018|S520181e-79translation initiation factor eIF-4A.11 - common tobacco299010414 (7)
JMFF043F20Sequence636010793 (25)pir|S52018|S520189e-85translation initiation factor eIF-4A.11 - common tobacco518010414 (7)gb:AF079782_17664069e-35Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF044E24Sequence622010793 (25)pir|S52018|S520183e-83translation initiation factor eIF-4A.11 - common tobacco591010414 (7)gb:AF079782_17664061e-46Zea mays translation initiation factor 4A2 (tif4A2) mRNA, partial cds.
JMFF050L24Sequence594010793 (25)pir|S52018|S520184e-79translation initiation factor eIF-4A.11 - common tobacco329010414 (7)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF006J05+ GGGAGTTCCGTTTTGGTTTTTCCAGGGTTTTAATCNC
rJMFF044E24+ AGGGACATCATCATGCGGGAGTTCCGTTCTGGTTCTTCCAGGGTTCTAATCAC
                      ____________________________________________________________
consensus AGGGACATCATCATGCGGGAGTTCCGTTTTGGTTTTTCCAGGGTTTTAATCAC
 
. : . : . : . : . : . :
rJMFF043F20+ TGGCCCGTGGTATCGATGTTCAACAAGTGTCCCTTGTTATCAACTATGA
rJMFF006J05+ CCCTGATTTTTTGGCCCGNGGTATNGANGTTCAACAAGNGTCCCTTGTTATCAACTNTGN
rJMFF044E24+ CACTGATCTCTTGGCCCGTGGTATCGATGTTCAACAAGTGTCCCTTGTTATCAACTATGA
                      ____________________________________________________________
consensus CCCTGATTTTTTGGCCCGTGGTATCGATGTTCAACAAGTGTCCCTTGTTATCAACTATGA
 
. : . : . : . : . : . :
rJMFF043F20+ CCTACCAACTCAGCCAGAGAACTACCTCCACCGTATCGGACGTAGTGGACGATTCGGTAG
rJMFF006J05+ CCTNCCAACTCANCCAGAGAACTNCCTCCCCCGTNTNGGACGTAGTGGNCGATTNGGTNG
rJMFF025G08+ GGACGTAGTGGNCGATTNGGTNG
rJMFF044E24+ CCTACCAACTCAGCCAGAGAACTACCTCCACCGTATCGGACGTAGTGGACGATTCGGTAG
                      ____________________________________________________________
consensus CCTACCAACTCAGCCAGAGAACTACCTCCACCGTATCGGACGTAGTGGACGATTCGGTAG
 
. : . : . : . : . : . :
rJMFF043F20+ GAAGGGTGTCGCCATCAACTTCGTTACAAAGGATGACGACAGAATGCTTTTTGACATACA
rJMFF006J05+ GAAGGGNGTNGCCATCAACTTNGTTNCAAAGGANGNCGNCAGAATGCTTTTTGACATNCA
rJMFF025G08+ GAAGGGNGTNGCCNTCAACTTNGTTNCAAAGGANGNCGNCAGAATGCTTTTTGACATNCA
rJMFF022C07+ AACTTTGTTNCAAAGGANGNCGNCAGAATGCTTTTTGACATNCA
rJMFF044E24+ GAAGGGTGTCGCCATCAACTTCGTTACAAAGGATGACGACAGAATGCTTTTTGACATACA
                      ____________________________________________________________
consensus GAAGGGTGTCGCCATCAACTTCGTTACAAAGGATGACGACAGAATGCTTTTTGACATACA
 
. : . : . : . : . : . :
rJMFF037K15+ TAACGTTGCAGATTTCCNGTAAAG
rJMFF043F20+ GAAGTTTTATAATGTTTTAGTTGAGGAGCTGCCGGCTAACGTTGCAGATCTCCTGTAATG
rJMFF006J05+ GAANTTTTATAANGTTTTAGTTGAGGAGCTGCCGGNTAACGTTGCAGATTTCCNGTAANG
rJMFF025G08+ GAANTTTTATAANGTTTTANTTGAGGAGCTGCCGGNTAACGTTGCAGATTTCCNGTAANG
rJMFF022C07+ GAANTTTTATAANGTTTTANTTGAGGAGNTGCCGGNTAACGTTGCAGATTTCCTGTAANG
rJMFF050L24+ AATGTTTTAGTTGAGGAGCTGCCGGCTAACGTTGCAGATTTCCCGTAAAG
rJMFF044E24+ GAAGTTTTATAATGTTTTAGTTGAGGAGCTGCCGGCTAACGTTGCAGATCTCCTGTAATG
                      ____________________________________________________________
consensus GAAGTTTTATAATGTTTTAGTTGAGGAGCTGCCGGCTAACGTTGCAGATTTCCTGTAATG
 
. : . : . : . : . : . :
rJMFF037K15+ NGGNTTTTGNTCNGG-AAAAAAAAAAGGTGAATGGGGTTCCTCCTTACATTAAGTAATTT
rJMFF043F20+ TGGTTTTTGCTCAGG-AAAAAAAAAAGGTGAATGGGGTTCCTCCTTACATTAAGTAATTT
rJMFF006J05+ TGGTTTTTGNTCAGG-AAAAAAAAAAGGTGAATGGGGTTCCTCCTTACATTAAGTAATTT
rJMFF025G08+ TGGNTTTTGNTCAGG-AAAAAAAAAAGGTGAATGGGGTTCCTCCTTACATTAAGTAATTT
rJMFF022C07+ NGGNTTTTGNTCAGG-AAAAAAAAAAGGTGAATGGGGTTCCTCCTTACATTAAGTAATTT
rJMFF050L24+ TGGTTTTTGCTCCGGAAAAAAAAAAAGGGGAATGGGGTTCCTCCTTCCCTTAAGTAATTT
rJMFF044E24+ TGGTTTTTGCTCAGG-AAAAAAAAAAGGTGAATGGGGTTCCTCCTTACATTAAGTAATTT
                      ____________________________________________________________
consensus TGGTTTTTGCTCAGG-AAAAAAAAAAGGTGAATGGGGTTCCTCCTTACATTAAGTAATTT
 
. : . : . : . : . : . :
rJMFF037K15+ TCGGTAGGTAATTTGGATGTGTAGTGAACTTGCAATTGGGAAAGACGATGGTAGGTTGGT
rJMFF043F20+ TCGGTAGGTAATTTGGATGTGTAGTGAACTTGCAATTGGGAAAGACGATGGTAGGTTGGT
rJMFF006J05+ TCGGTAGGTAATTTGGATGTGTAGTGAACTTGCAATTGGGAAAGACGATGGTAGGTTGGT
rJMFF025G08+ TCGGTAGGTAATTTGGATGTGTAGTGAACTTGCAATTGGGAAAGACGATGGTAGGTTGGT
rJMFF022C07+ TCGGTAGGTAATTTGGATGTGTAGTGAACTTGCAATTGCGAAAGACGATGGTAGGTTGGT
rJMFF050L24+ TCGGTAGGTAATTTGGAGGTGTAGGGAACTTCCAATTGGGAAAGACGATGGTAGGTTGGT
rJMFF044E24+ TCGGTAGGTAATTTGGATGTGTAGTGAACTTGCAATTGGGAAAGACGATGGTAGGTTGGT
                      ____________________________________________________________
consensus TCGGTAGGTAATTTGGATGTGTAGTGAACTTGCAATTGGGAAAGACGATGGTAGGTTGGT
 
. : . : . : . : . : . :
rJMFF037K15+ CCTGGAACTTGCAAAATTGGGGAATTGCAGTTTTTTTTTTCCCAGTTTGGTCATAGAGTT
rJMFF043F20+ CCTGGAACTTGCAAAATTGGGGAATTGCAGTTTTTTTTTTCCCAGTTTGGTCATAGAGTT
rJMFF006J05+ CCTGGAACTTGCAAAATTGGGGAATTGCAG-TTTTTTTTTCCCAGTTTGGTCATAGAGTT
rJMFF025G08+ CCTGGAACTTGCAAAATTGGGGAATTGCAG-TTTTTTTTTCCCAGTTTGGTCATAGAGTT
rJMFF022C07+ CCTGGAACTTGCAAAATTGGGGAATTGCAG-TTTTTTTTTCCCAGTTTGGTCATAGAGTT
rJMFF050L24+ CCTGGAACTTGCAAAATTGGGGAATTGCAG-TTTTTTTTTCCCAGTTTGGTCATAGAGTT
rJMFF044E24+ CCTGGAACTTGCAAAATTGGGGAATTGCAG-TTTTTTTTTCCCAGTTTGGTCATAGAGTT
                      ____________________________________________________________
consensus CCTGGAACTTGCAAAATTGGGGAATTGCAG-TTTTTTTTTCCCAGTTTGGTCATAGAGTT
 
. : . : . : . : . : . :
rJMFF037K15+ TGAATCTGCTGTTGCAAATTTTGTTGGTTTTTGTCTTTTGTGCTTTTCTTAAATGTCCAA
rJMFF043F20+ TGAATCTGCTGTTGCAAATTTTGTTGGTTTTTGTCTTTTGTGCTTTTCTTAAATGTCCAA
rJMFF006J05+ TGAATCTGCTGTTGCAAATTTTGTTGGTTTTTGTCTTTTGTGCTTTTCTTAAATGTCCAA
rJMFF025G08+ TGAATCTGCTGTTGCAAATTTTGTTGGTTTTTGTCTTTTGTGCTTTTCTTAAATGTCCAA
rJMFF022C07+ TGAATCTGCTGTTGCAAATTTTGTTGGTTTTTGTCTTTTGTGCTTTTCTTAAATGTCCAA
rJMFF050L24+ TGAATTTGCTGTTGCAAATTTTGTTGGTTTTTGTCTTTTGGGCTTTTCTTAAATGTCCAA
rJMFF044E24+ TGAATCTGCTGTTGCAAATTTTGTTGGTTTTTGTCTTTTGTGCTTTTCTTAAATGTCCAA
                      ____________________________________________________________
consensus TGAATCTGCTGTTGCAAATTTTGTTGGTTTTTGTCTTTTGTGCTTTTCTTAAATGTCCAA
 
. : . : . : . : . : . :
rJMFF037K15+ AACAACTGCAGTACTGAATGTTGTTTAAATTAA
rJMFF043F20+ AACAACTGCAGTACTGAATGTTGTTTAAATTAATGACTTCATT
rJMFF006J05+ AACAACTGCAGTACTGAATGTTGTTTAAATTA
rJMFF025G08+ AACAACTGCAGTACTGAATGTTGTTTAAATTAA
rJMFF022C07+ AACAACTGCAGTACTGAATGTTGTTTAAATTAATGACTTCATT
rJMFF050L24+ AACAACTGCAGTACTGAATGTTGTTTAAATTAAAGACTTC
rJMFF044E24+ AACAACTGCAGTACTGAATGTTGTTTAAATTAATGACTTCATTGGTTTTTTAAAAAAAAG
                      ____________________________________________________________
consensus AACAACTGCAGTACTGAATGTTGTTTAAATTAATGACTTCATTGGTTTTTTAAAAAAAAG