Previous Contig 010410:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007C07Sequence507010410 (9)gb:AY087347_15723791e-59Arabidopsis thaliana clone 34470 mRNA, complete sequence.689010410 (9)gb:AY087347_15723797e-31Arabidopsis thaliana clone 34470 mRNA, complete sequence.
JMFF013I08Sequence583010410 (9)gb:AY087347_15723795e-17Arabidopsis thaliana clone 34470 mRNA, complete sequence.
JMFF033G13Sequence728010410 (9)gb:AY087347_15723796e-50Arabidopsis thaliana clone 34470 mRNA, complete sequence.
JMFF044E12Sequence643010410 (9)gb:AY087347_15723797e-77Arabidopsis thaliana clone 34470 mRNA, complete sequence.651010410 (9)gb:AY087347_15723794e-17Arabidopsis thaliana clone 34470 mRNA, complete sequence.
JMSF023M02Sequence673010410 (9)gb:AY087347_15723794e-83Arabidopsis thaliana clone 34470 mRNA, complete sequence.709010410 (9)pir|T06053|T060535e-42probable ubiquitin-dependent proteolytic protein - Arabidopsis thaliana>gb:ATCHR
JMSF039K18Sequence653010410 (9)gb:AY087347_15723792e-73Arabidopsis thaliana clone 34470 mRNA, complete sequence.920023865gb:AY087347_1572379e-107Arabidopsis thaliana clone 34470 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF039K18- GATAGAACGTAGCGTATCTTACCCCCTTTCTTCTCTTCAATATTTTTC
                      ____________________________________________________________
consensus GATAGAACGTAGCGTATCTTACCCCCTTTCTTCTCTTCAATATTTTTC
 
. : . : . : . : . : . :
JMSF039K18- TCCTTTTAACACTGCACCTTTCGGCTTTCGCCTCTGCAAAAAGCCAAAAATTTAAAAATT
                      ____________________________________________________________
consensus TCCTTTTAACACTGCACCTTTCGGCTTTCGCCTCTGCAAAAAGCCAAAAATTTAAAAATT
 
. : . : . : . : . : . :
JMSF039K18- CTGCCGAAAAATTGTAGCAATCATCTTCCTGGTTTCTACTTTCCTCGCTTCCGATCAGAG
                      ____________________________________________________________
consensus CTGCCGAAAAATTGTAGCAATCATCTTCCTGGTTTCTACTTTCCTCGCTTCCGATCAGAG
 
. : . : . : . : . : . :
JMSF039K18- AGAGCTGAGACAGTTGATCTGGTGGTTAAGCTAGCCAGAAATAGTAATTATGTTTTTTGA
JMFF007C07- ATAGTAATCATGTTCTTTGA
JMFF044E12- ATAGTAATCATGTTCTTTGA
JMSF023M02- ATAGTAATCATGTTCTTTGA
                      ____________________________________________________________
consensus AGAGCTGAGACAGTTGATCTGGTGGTTAAGCTAGCCAGAAATAGTAATCATGTTCTTTGA
 
. : . : . : . : . : . :
JMSF039K18- TGGATATGGTTACCATGGAACATCATTTGAGCAAACATATCGATGTTATCCTGCATCATT
JMFF007C07- TGGATATGGTTACCATGGAACATCATTCGAACAAACATATCGATGCTACCCTGCCTCTTT
JMFF044E12- TGGATATGGTTACCATGGAACATCATTCGAACAAACATATCGATGCTACCCTGCCTCTTT
JMSF023M02- TGGATATGGTTACCATGGAACATCATTCGAACAAACATATCGATGCTACCCTGCCTCTTT
                      ____________________________________________________________
consensus TGGATATGGTTACCATGGAACATCATTCGAACAAACATATCGATGCTACCCTGCCTCTTT
 
. : . : . : . : . : . :
JMSF039K18- TATTGATAAGCCTCAGATAGAAAATGGTGACAAAATTATAATGCCTCCATCTGCCCTTGA
JMFF007C07- CATTGACAAGCCTCATCTAGAAAATGGTGACAAAATTATAATGCCTCCATCTGCTCTTGA
JMFF044E12- CATTGACAAGCCTCATCTAGAAAATGGTGACAAAATTATAATGCCTCCATCTGCTCTTGA
JMSF023M02- CATTGACAAGCCTCATCTAGAAAATGGTGACAAAATTATAATGCCTCCATCTGCTCTTGA
                      ____________________________________________________________
consensus CATTGACAAGCCTCATCTAGAAAATGGTGACAAAATTATAATGCCTCCATCTGCTCTTGA
 
. : . : . : . : . : . :
JMSF039K18- TCGCCTTGCATCTCTACATATTGACTATCCAATGTTGTTTGAGCTTCGCAATGCTGCAAC
JMFF007C07- TCGCCTTGCTTCTCTTCACATTGACTACCCAATGTTGTTTGAGCTTAGTAATGCTGCCAC
JMFF044E12- TCGCCTTGCTTCTCTTCACATTGACTACCCAATGTTGTTTGAGCTTAGTAATGCTGCCAC
JMSF023M02- TCGCCTTGCTTCTCTTCACATTGACTACCCAATGTTGTTTGAGCTTAGTAATGCTGCCAC
                      ____________________________________________________________
consensus TCGCCTTGCTTCTCTTCACATTGACTACCCAATGTTGTTTGAGCTTAGTAATGCTGCCAC
 
. : . : . : . : . : . :
JMSF039K18- GGAGCGGGTTTCTCATTGTGGGGTTCTGGAGTTCATTGCAGAAGAAGGCATGATATATAT
JMFF007C07- AGAGAGAGTTTCACATTGTGGGGTTTTGGAGTTTATTGCAGAGGAGGGCATGATATATAT
JMFF044E12- AGAGAGAGTTTCACATTGTGGGGTTTTGGAGTTTATTGCAGAGGAGGGCATGATATATAT
JMSF023M02- AGAGAGAGTTTCACATTGTGGGGTTTTGGAGTTTATTGCAGAGGAGGGCATGATATATAT
                      ____________________________________________________________
consensus AGAGAGAGTTTCACATTGTGGGGTTTTGGAGTTTATTGCAGAGGAGGGCATGATATATAT
 
. : . : . : . : . : . :
JMSF039K18- GCCATATTGGATGATGGAAAATTTATTGTTGCAAGAAGGAGACTTTATACGAGTGAAAAA
JMFF007C07- GCCATATTGGATGATGGAAAATTTGTTGTTACAAGAAGGAGACATTGTACGAGTGAAAAA
JMFF044E12- GCCATATTGGATGATGGAAAATTTGTTGTTACAAGAAGGAGACATTGTACGAGTGAAAAA
JMSF023M02- GCCATATTGGATGATGGAAAATTTGTTGTTACAAGAAGGAGACATTGTACGAGTGAAAAA
                      ____________________________________________________________
consensus GCCATATTGGATGATGGAAAATTTGTTGTTACAAGAAGGAGACATTGTACGAGTGAAAAA
 
. : . : . : . : . : . :
JMSF039K18- TGTTGCTCTTCCAAAGGGTACATATGTAAAATTGCAACCGCACACAAAAGATTTCCTGGA
JMFF007C07- TGTTACTCTTCCCAAGGGTAAATATGTGAAACTGCAACCCCACACA
JMFF044E12- TGTTACTCTTCCCAAGGGTAAATATGTGAAACTGCAACCCCACACAAAAGATTTTCTGGA
JMSF023M02- TGTTACTCTTCCCAAGGGTAAATATGTGAAACTGCAACCCCACACAAAAGATTTTCTGGA
                      ____________________________________________________________
consensus TGTTACTCTTCCCAAGGGTAAATATGTGAAACTGCAACCCCACACAAAAGATTTTCTGGA
 
. : . : . : . : . : . :
JMSF039K18- TATTTCCAACCCAAAAGCCATCTTGGAGACAACACTGAGGAATTTCTCTTGCTTAACCAC
JMFF044E12- TATTTCGAACCCAAAGGCCATCTTGGAGACNACACTCAGGAACTTTTCTTGCCTAACCAC
JMSF023M02- TATTTCGAACCCAAAGGCCATCTTGGAGACAACACTCAGGAACTTTTCTTGCCTAACCAC
rJMFF033G13+ AACCCAAAGGCCATNTNGGAGACAACACTCAGGAACTTTTCTTGCCTAACCAC
rJMSF023M02+ TCAGGAACTTTTCTTGCCTAACCAC
                      ____________________________________________________________
consensus TATTTCGAACCCAAAGGCCATCTTGGAGACAACACTCAGGAACTTTTCTTGCCTAACCAC
 
. : . : . : . : . : . :
JMSF039K18- AGG
JMFF044E12- AGGCGATAGCATTATGGTGGCTTATAATNA-ACAAAGTATTACATTGAT
JMSF023M02- AGGCGATAGCATTATGGTGGCTTATAATAACAAAAAGTATTACATTGATATAAT
rJMFF033G13+ AGGCGATAGCATTATGGTGGCTTATAATAACAAAAAGTATTACATTGATATAATCGAGTC
rJMSF023M02+ AGGCGATAGCATTATGGTGGCTTATAATAACAAAAAGTATTACATTGATATAATCGAGTC
                      ____________________________________________________________
consensus AGGCGATAGCATTATGGTGGCTTATAATAACAAAAAGTATTACATTGATATAATCGAGTC
 
. : . : . : . : . : . :
rJMFF033G13+ GAAGCCGTCTAATGCAATAAGTATTATTGAGACGGACTGTGAAGTGGACTTTGCTCCTCC
rJMSF023M02+ GAAGCCGTCTAATGCAATAAGTATTATTGAGACGGACTGTGAAGTGGACTTTGCTCCTCC
                      ____________________________________________________________
consensus GAAGCCGTCTAATGCAATAAGTATTATTGAGACGGACTGTGAAGTGGACTTTGCTCCTCC
 
. : . : . : . : . : . :
rJMFF033G13+ TCTTGATTATAAAGAACCTGAAAGGCCTGTTTCTTCTCT-AAAAAACAAGGCCCCCGCAG
rJMSF023M02+ TCTTGATTATAAAGAACCTGAAAGGCCTGTTTCTTCTCTAAAAAAACAAGGCCCCCGCAG
rJMFF013I08+ CT-AAAAAACAAGGCCCCCGCAG
rJMFF044E12+ TATAAAGAACCTGAAAGGCCTG-TTCTTCTCT-AAAAAACAAGGCCCCCGCAG
                      ____________________________________________________________
consensus TCTTGATTATAAAGAACCTGAAAGGCCTGTTTCTTCTCT-AAAAAACAAGGCCCCCGCAG
 
. : . : . : . : . : . :
rJMFF033G13+ AAGAGGCTGAAGCTGAGGCCGAACCAAAATTCAACCCTTTTACTGGTGCGGGAAGACGCT
rJMSF023M02+ AAGAGGCTGAAGCTGAGGCCGAACCAAAATTCAACCCTTTTACTGGTGCGGGAAGACGCT
rJMFF013I08+ AAGAGGCTGAAGCTGAGGCCGAACCAAAATTCAACCCTTTTACTGGTGCGGGAAGACGCT
rJMFF007C07+ ACCAAAATTCAACCCTTTTACTGGTGCGGGAAGACGCT
rJMFF044E12+ AAGAGGCTGAAGCTGAGGCCGAACCAAAATTCAACCCTTTTACTGGTGCGGGAAGACGCT
                      ____________________________________________________________
consensus AAGAGGCTGAAGCTGAGGCCGAACCAAAATTCAACCCTTTTACTGGTGCGGGAAGACGCT
 
. : . : . : . : . : . :
rJMFF033G13+ TGGATGGGAAACCTTTGAAGTATGACCCTCCTCCTGTTTCCTCGTCCAGCTCCAAGGACA
rJMSF023M02+ TGGATGGGAAACCTTTGAAGTATGACCCTCCTCCTGTTTCCTCGTCCAGCTCCAAGGACA
rJMFF013I08+ TGGATGGGAAACCTTTGAAGTATGACCCTCCTCCTGTTTCCTCGTCCAGCTCCAAGGACA
rJMFF007C07+ TGGATGGGAAACCTTTGAAGTATGACCCTCCTCCTGTTTCCTCGTCCAGCTCCAAGGACA
rJMFF044E12+ TGGATGGGAAACCTTTGAAGTATGACCCTCCTCCTGTTTCCTCGTCCAGCTCCAAGGACA
                      ____________________________________________________________
consensus TGGATGGGAAACCTTTGAAGTATGACCCTCCTCCTGTTTCCTCGTCCAGCTCCAAGGACA
 
. : . : . : . : . : . :
rJMFF033G13+ TTAGAGCTGATGTAGCCAACAACACTGCGAAGTCTTNTGCTGGATCGAGCTCCCAAAACA
rJMSF023M02+ TTAGAGCTGATGTAGCCAACAACACTGCGAAGTCTTCTGCTGGATCGAGCTCCCAAAACA
rJMFF013I08+ TTAGAGCTGATGTAGCCAACAACACTGCGAAGTCTTCTGCTGGATCGAGCTCCCAAAACA
rJMFF007C07+ TTAGAGCTGATGTAGCCAACAACACTGCGAAGTCTTCTGCTGGATCGAGCTCCCAAAACA
rJMFF044E12+ TTAGAGCTGATGTAGCCAACAACACTGCGAAGTCTTCTGCTGGATCGAGCTCCCAAAACA
                      ____________________________________________________________
consensus TTAGAGCTGATGTAGCCAACAACACTGCGAAGTCTTCTGCTGGATCGAGCTCCCAAAACA
 
. : . : . : . : . : . :
rJMFF033G13+ CTAGTCGTCAATCTCAGGGGAAACTTGTTTTTGGTTCCAATGCAAATCGCAATCAGGAGA
rJMSF023M02+ CTAGTCGTCAATCTCAGGGGAAACTTGTTTTTGGTTCCAATGCAAATCGCAATCAGGAGA
rJMFF013I08+ CTAGTCGTCAATCTCAGGGGAAACTTGTTTTTGGTTCCAATGCAAATCGCAATCAGGAGA
rJMFF007C07+ CTAGTCGTCAATCTCAGGGGAAACTTGTTTTTGGTTCCAATGCAAATCGCAATCAGGAGA
rJMFF044E12+ CTAGTCGTCAATCTCAGGGGAAACTTGTTTTTGGTTCCAATGCAAATCGCAATCAGGAGA
                      ____________________________________________________________
consensus CTAGTCGTCAATCTCAGGGGAAACTTGTTTTTGGTTCCAATGCAAATCGCAATCAGGAGA
 
. : . : . : . : . : . :
rJMFF033G13+ CACCTAAGGAACCCACCAAAAAAGAGCCTGAGAAGAAAGAAGAGCCAAAGTTCCAAGCTT
rJMSF023M02+ CACCTAAGGAACCCACCAAAAAAGAGCCTGAGAAGAAAGAAGAGCCAAAGTTCCAAGCTT
rJMFF013I08+ CACCTAAGGAACCCACCAAAAAAGAGCCTGAGAAGAAAGAAGAGCCAAAGTTCCAAGCTT
rJMFF007C07+ CACCTAAGGAACCCACCAAAAAAGAGCCTGAGAAGAAAGAAGAGCCAAAGTTCCAAGCTT
rJMFF044E12+ CACCTAAGGAACCCACCAAAAAAGAGCCTGAGAAGAAAGAAGAGCCAAAGTTCCAAGCTT
                      ____________________________________________________________
consensus CACCTAAGGAACCCACCAAAAAAGAGCCTGAGAAGAAAGAAGAGCCAAAGTTCCAAGCTT
 
. : . : . : . : . : . :
rJMFF033G13+ TCACTGGCAAAAAGTATTCTNTGAGGGGTTGATTGTCTCGTGTCCTTTTTAAGTTATGAC
rJMSF023M02+ TCACTGGCAAAAAGTATTCTCTGAGGGGTTGATTGTCTCGTGTCCTTTTTAAGTTATGAC
rJMFF013I08+ TCACTGGCAAAAAGTATTCTCTGAGGGGTTGATTGTCTCGTGTCCTTTTTAAGTTATGAC
rJMFF007C07+ TCACTGGCAAAAAGTATTCTCTGAGGGGTTGATTGTCTCGTGTCCTTTTTAAGTTATGAC
rJMFF044E12+ TCACTGGCAAAAAGTATTCTCTGAGGGGTTGATTGTCTCGTGTCCTTTTTAAGTTATGAC
                      ____________________________________________________________
consensus TCACTGGCAAAAAGTATTCTCTGAGGGGTTGATTGTCTCGTGTCCTTTTTAAGTTATGAC
 
. : . : . : . : . : . :
rJMFF033G13+ ATTTTCCTTAATGCCCTGCCACTTTCTCTCAGCCAGAAGTAGTAACTGTGCTGAAAGATT
rJMSF023M02+ ATTTTCCTTAATGCCCTGCCACTTTCTCTCAGCCAGAAGTAGTAACTGTGCTGAAAGATT
rJMFF013I08+ ATTTTCCTTAATGCCCTGCCACTTTCTCTCAGCCAGAAGTAGTAACTGTGCTGAAAGATT
rJMFF007C07+ ATTTTCCTTAATGCCCTGCCACTTTCTCTCAGCCAGAAGTAGTAACTGTGCTGAAAGATT
rJMFF044E12+ ATTTTCCTTAATGCCCTGCCACTTTCTCTCAGCCAGAAGTAGTAACTGTGCTGAAAGATT
                      ____________________________________________________________
consensus ATTTTCCTTAATGCCCTGCCACTTTCTCTCAGCCAGAAGTAGTAACTGTGCTGAAAGATT
 
. : . : . : . : . : . :
rJMFF033G13+ TAAAATATTGCTTTAGAACAGTATATGCTGTTACACATTGTGAATGGTATAGGACTTGTA
rJMSF023M02+ TAAAATATTGCTTTAGAACAGTATATGCTGTTACACATTGTGAATGGTATAGGACTTGTA
rJMFF013I08+ TAAAATATTGCTTTAGAACAGTATATGCTGTTACACATTGTGAATGGTATAGGACTTGTA
rJMFF007C07+ TAAAATATTGCTTTAGAACAGTATATGCTGTTACACATTGTGAATGGTATAGGACTTGTA
rJMFF044E12+ TAAAATATTGCTTTAGAACAGTATATGCTGTTACACATTGTGAATGGTATAGGACTTGTA
                      ____________________________________________________________
consensus TAAAATATTGCTTTAGAACAGTATATGCTGTTACACATTGTGAATGGTATAGGACTTGTA
 
. : . : . : . : . : . :
rJMFF033G13+ TGTTCATATTCACGG
rJMSF023M02+ TGTTCATATTCACGGTACAGCCTT
rJMFF013I08+ TGTTCATATTCACGGTACAGCCTTTTACAATTGTGGGGAGATTTGGACTACAATGACACT
rJMFF007C07+ TGTTCATATTCACGGTACAGCCTTTTACAATTGTGGGGAGATTTGGACTACAATGACACT
rJMFF044E12+ TGTTCATATTCACGGTACAGCCTTTTACAATTGTGGGGAGATTTGGACTACAATGACACT
                      ____________________________________________________________
consensus TGTTCATATTCACGGTACAGCCTTTTACAATTGTGGGGAGATTTGGACTACAATGACACT
 
. : . : . : . : . : . :
rJMFF013I08+ TTACATTTTAATGCC
rJMFF007C07+ TTACATTTTAATGCC
rJMFF044E12+ TTACATTTTAATGCCAAAAAAAAAAAAAAAAACACTCCAGGGTGATCCGCCATAAGGGCC
                      ____________________________________________________________
consensus TTACATTTTAATGCCAAAAAAAAAAAAAAAAACACTCCAGGGTGATCCGCCATAAGGGCC