Previous Contig 010405:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044D05Sequence632006209 (4)gb:AP002484_18222323e-35Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0489A01616010405 (2)pir|G96611|G966111e-21probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_
JMSF024F08Sequence707006209 (4)gb:AP002484_18222321e-37Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0489A01727010405 (2)pir|G96611|G966112e-42probable cytochrome P450 T8L23.21 [imported] - Arabidopsis thaliana>gb:AE005173_

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024F08+ CCTCAGGTTGAAGCAAAGATCCTCCACGACATCCT
                      ____________________________________________________________
consensus CCTCAGGTTGAAGCAAAGATCCTCCACGACATCCT
 
. : . : . : . : . : . :
rJMSF024F08+ TCAACTCAAACAAGACAAGAAGGTTTTTAAGGTAGAAGAATGCCAGAAGTTAACCTATCT
                      ____________________________________________________________
consensus TCAACTCAAACAAGACAAGAAGGTTTTTAAGGTAGAAGAATGCCAGAAGTTAACCTATCT
 
. : . : . : . : . : . :
rJMSF024F08+ CCACGCTGCCTTTTGTGAATCTCTCGGGTTATTTCCTCCGGTTCCTTTGAACCACAAGAA
                      ____________________________________________________________
consensus CCACGCTGCCTTTTGTGAATCTCTCGGGTTATTTCCTCCGGTTCCTTTGAACCACAAGAA
 
. : . : . : . : . : . :
rJMSF024F08+ CCCGATGGAGAAGGATATTCTCCCCAGCGGCCATGTTGTTACTCCAAACACCAAAATAAT
                      ____________________________________________________________
consensus CCCGATGGAGAAGGATATTCTCCCCAGCGGCCATGTTGTTACTCCAAACACCAAAATAAT
 
. : . : . : . : . : . :
rJMSF024F08+ AATGCCATTTTATTCCATGGGGAGGATGGATACCGTGTGGGGTGAAGACTGCATGGAGTT
rJMFF044D05+ AAGATTGCATGGAGTT
                      ____________________________________________________________
consensus AATGCCATTTTATTCCATGGGGAGGATGGATACCGTGTGGGGTGAAGATTGCATGGAGTT
 
. : . : . : . : . : . :
rJMSF024F08+ CAAGCCCGAGAGGTGGATTTCGCCCGATGGTGGAATCAAACGCCAACCTTCTTACAAGTA
rJMFF044D05+ CAAGCCCGAGAGGTGGATTTCACCAGATGGTGGAATCAAACGCCAACCTTCTTACAAGTT
                      ____________________________________________________________
consensus CAAGCCCGAGAGGTGGATTTCGCCCGATGGTGGAATCAAACGCCAACCTTCTTACAAGTT
 
. : . : . : . : . : . :
rJMSF024F08+ TCCCGTCTTCAATGCTGGACCAAGAACTTGCATAGGCAGGGATATGGCTTTCACTGTGGT
rJMFF044D05+ TTCGGTCTTTAATGCTGGACCCAGAACTTGCATAGGCAAGGATATGGCTTTCACTATGGT
                      ____________________________________________________________
consensus TTCGGTCTTTAATGCTGGACCCAGAACTTGCATAGGCAGGGATATGGCTTTCACTGTGGT
 
. : . : . : . : . : . :
rJMSF024F08+ GAAAATGGTTGCAGCTACCATAATATGTCACTATCAATTTCAACTGGTGGAACTTCATCA
rJMFF044D05+ CAAAATGATTGCAGCTACCATAATATGTCACTATCAATTTCAACTGGTGGAATCTCATCA
                      ____________________________________________________________
consensus GAAAATGGTTGCAGCTACCATAATATGTCACTATCAATTTCAACTGGTGGAATTTCATCA
 
. : . : . : . : . : . :
rJMSF024F08+ TCCACAAATTCTATTTACTGATTCAATGATTCTGAAAAAGAAACATGGTTTGAAGGTTAA
rJMFF044D05+ TCTAGAAATTCTATCTACTGATTCAATCATTCTAGAGAAGAAACATGGTTTGAAGGTCAA
                      ____________________________________________________________
consensus TCTAGAAATTCTATTTACTGATTCAATGATTCTGGAGAAGAAACATGGTTTGAAGGTTAA
 
. : . : . : . : . : . :
rJMSF024F08+ ATTAATCAAACGTAAGTAAAACTATCAACTTAATTTCATTCTGAGCTCTCAGCTCTACTA
rJMFF044D05+ ATTCAACAAACGTAAGTAAGATTATCAACTTAATTTCATTCTCAACTCTCAGCTCTACTA
                      ____________________________________________________________
consensus ATTCATCAAACGTAAGTAAGATTATCAACTTAATTTCATTCTGAGCTCTCAGCTCTACTA
 
. : . : . : . : . : . :
rJMSF024F08+ TC
rJMFF044D05+ TCCAGCCTCATATTAATTAGTGCAAGTCTGATCTGATCTTGTGTTTAAAGTACTCTAGTG
                      ____________________________________________________________
consensus TCCAGCCTCATATTAATTAGTGCAAGTCTGATCTGATCTTGTGTTTAAAGTACTCTAGTG
 
. : . : . : . : . : . :
rJMFF044D05+ TATATATATATATATATATATATATATATATATATGATTATTATGTTCATATGATTCATA
                      ____________________________________________________________
consensus TATATATATATATATATATATATATATATATATATGATTATTATGTTCATATGATTCATA
 
. : . : . : . : . : . :
rJMFF044D05+ AGTATTCCTTATGTGAATCTTATATACTTGTCATTGTTAAATCCTTGCTGTGCAGAATTA
                      ____________________________________________________________
consensus AGTATTCCTTATGTGAATCTTATATACTTGTCATTGTTAAATCCTTGCTGTGCAGAATTA
 
. : . : . : . : . : . :
rJMFF044D05+ TTGATAATGAGTTCTACTGCTCAGGTTAGATAAAAGTGTATGCGTCTTTTAACTTGTACG
                      ____________________________________________________________
consensus TTGATAATGAGTTCTACTGCTCAGGTTAGATAAAAGTGTATGCGTCTTTTAACTTGTACG
 
. : . : . : . : . : . :
rJMFF044D05+ TCTTTACTTTTTTATATGTAATGAAAGTTGTGTGTACTAATAAAGTATTCCGTTATGAAT
                      ____________________________________________________________
consensus TCTTTACTTTTTTATATGTAATGAAAGTTGTGTGTACTAATAAAGTATTCCGTTATGAAT