Previous Contig 010404:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF037J06Sequence570005901 (8)pir|T04188|T041882e-49subtilisin-like proteinase homolog F7L13.110 - Arabidopsis thaliana>gb:ATCHRIV29754010404 (7)pir|T04187|T041877e-72subtilisin-like proteinase homolog F7L13.100 - Arabidopsis thaliana>gb:ATCHRIV29
JMFF044D02Sequence639005901 (8)pir|T04188|T041882e-57subtilisin-like proteinase homolog F7L13.110 - Arabidopsis thaliana>gb:ATCHRIV29642010404 (7)pir|A86454|A864542e-50hypothetical protein F9L11.11 - Arabidopsis thaliana>gb:AE005172_892125 Arabidop
JMFS082B11Sequence564010404 (7)pir|B86454|B864547e-42hypothetical protein F9L11.12 - Arabidopsis thaliana>gb:AE005172_892126 Arabidop
JMSF020H14Sequence590005901 (8)pir|T04188|T041885e-50subtilisin-like proteinase homolog F7L13.110 - Arabidopsis thaliana>gb:ATCHRIV29785010404 (7)pir|A86454|A864543e-70hypothetical protein F9L11.11 - Arabidopsis thaliana>gb:AE005172_892125 Arabidop
JMSF027N23Sequence607005901 (8)pir|T04188|T041881e-50subtilisin-like proteinase homolog F7L13.110 - Arabidopsis thaliana>gb:ATCHRIV29692010404 (7)pir|T05174|T051744e-58hypothetical protein T6K22.50 - Arabidopsis thaliana>gb:ATCHRIV54_1545969 Arabid
JMSF037D10Sequence675005901 (8)pir|T04187|T041873e-60subtilisin-like proteinase homolog F7L13.100 - Arabidopsis thaliana>gb:ATCHRIV29746010404 (7)pir|T05174|T051741e-69hypothetical protein T6K22.50 - Arabidopsis thaliana>gb:ATCHRIV54_1545969 Arabid
JMSF046G01Sequence711005901 (8)pir|T04187|T041874e-61subtilisin-like proteinase homolog F7L13.100 - Arabidopsis thaliana>gb:ATCHRIV29803010404 (7)pir|A86454|A864543e-71hypothetical protein F9L11.11 - Arabidopsis thaliana>gb:AE005172_892125 Arabidop

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF046G01+ TATATTAGCAGCATATATTCCTAGTGATC
                      ____________________________________________________________
consensus TATATTAGCAGCATATATTCCTAGTGATC
 
. : . : . : . : . : . :
rJMSF020H14+ CGAATTAGTACGTATAACCTTATCAGCGGAACATNTATGGCAACACCACATG
rJMFF037J06+ CGAATTAGTACGTATAACTTTATCAGCGGAACATCTATGGCAACACCACATG
rJMSF046G01+ CTGCTGTGCGAATTAGTACGTATAACTTTATCAGCGGAACATCTATGGCAACACCACATG
rJMSF037D10+ AGCGGAACATTTATGGCAACACCACATG
                      ____________________________________________________________
consensus CTGCTGTGCGAATTAGTACGTATAACTTTATCAGCGGAACATCTATGGCAACACCACATG
 
. : . : . : . : . : . :
rJMSF020H14+ TGGCAGGAATAGTTGCACTACTCAAAGCTGCCCACCCAGATTGGTCTCCAGCTGTTATAA
rJMFF037J06+ TGGCAGGAATAGTTGCACTACTCAAAGCTGCCCACCCAGATTGGTCTCCAGCTGTTATAA
rJMSF046G01+ TGGCAGGAATAGTTGCACTACTCAAAGCTGCCCACCCAGATTGGTCTCCAGCTGTTATAA
rJMSF037D10+ TGGCAGGAATAGTTGCACTACTCAAAGCTGCCCACCCAGATTGGTCTCCAGCTGTTATAA
rJMSF027N23+ AGCTGCCCACCCAGATTGGTCTCCAGCTGTTAT-A
                      ____________________________________________________________
consensus TGGCAGGAATAGTTGCACTACTCAAAGCTGCCCACCCAGATTGGTCTCCAGCTGTTATAA
 
. : . : . : . : . : . :
rJMSF020H14+ AATCTGCAATTGTCACAACAGCATGGACAACTGACCGATCGTCTGGAGAACCTATATTTA
rJMFF037J06+ AATCTGCAATTGTCACAACAGCATGGACAACTGACCGATCGTCTGGAGAACCTATATTTA
rJMSF046G01+ AATCTGCAATTGTCACAACAGCATGGACAACTGACCGATCGTCTGGAGAACCTATATTTA
rJMSF037D10+ AATCTGCAATTGTCACAACAGCATGGACAACTGACCGATCGTCTGGAGAACCTATATTTA
rJMSF027N23+ AATCTGCAATTGTCACAACAGCATGGACAACTGACCGATCGTCTGGAGAACCTATATTTA
                      ____________________________________________________________
consensus AATCTGCAATTGTCACAACAGCATGGACAACTGACCGATCGTCTGGAGAACCTATATTTA
 
. : . : . : . : . : . :
rJMSF020H14+ ATGAAGGAGAGACAATTAGTAAGTTGGCAGATGCATTTGACTATGGGGGAGGGATCATAA
rJMFF037J06+ ATGAAGGAGAGACAATTAGTAAGTTGGCAGATGCATTTGACTATGGGGGAGGGATCATAA
rJMSF046G01+ ATGAAGGAGAGACAATTAGTAAGTTGGCAGATGCATTTGACTATGGGGGAGGGATCATAA
rJMSF037D10+ ATGAAGGAGAGACAATTAGTAAGTTGGCAGATGCATTTGACTATGGGGGAGGGATCATAA
rJMSF027N23+ ATGAAGGAGAGACAATTAGTAAGTTGGCAGATGCATTTGACTATGGGGGAGGGATCATAA
rJMFF044D02+ GTAAGTTGGCAGATGCATTTGACTATGGGGGAGGGATCATAA
                      ____________________________________________________________
consensus ATGAAGGAGAGACAATTAGTAAGTTGGCAGATGCATTTGACTATGGGGGAGGGATCATAA
 
. : . : . : . : . : . :
rJMSF020H14+ ATCCTAATAGAGCAAGAAAACCCGGCCTCGTTTATGATATGAGCACAACAGATTATGTTA
rJMFF037J06+ ATCCTAATAGAGCAAGAAAACCCGGCCTCGTTTATGATATGAGCACAACAGATTATGTTA
rJMSF046G01+ ATCCTAATAGAGCAAGAAAACCCGGCCTCGTTTATGATATGAGCACAACAGATTATGTTA
rJMSF037D10+ ATCCTAATAGAGCAAGAAAACCCGGCCTCGTTTATGATATGAGCACAACAGATTATGTTA
rJMSF027N23+ ATCCTAATAGAGCAAGAAAACCCGGCCTCGTTTATGATATGAGCACAACAGATTATGTTA
JMFS082B11+ AAACCCGGCCTCGTTTATGATATGAGCACAACAGATTATGTTA
rJMFF044D02+ ATCCTAATAGAGCAAGAAAACCCGGCCTCGTTTATGATATGAGCACAACAGATTATGTTA
                      ____________________________________________________________
consensus ATCCTAATAGAGCAAGAAAACCCGGCCTCGTTTATGATATGAGCACAACAGATTATGTTA
 
. : . : . : . : . : . :
rJMSF020H14+ ACTGTCTTTGTGCCATGGGATATAGCAGCAAAGCCATTAGTATAATTGCAGGACAAACCA
rJMFF037J06+ ACTGTCTTTGTGCCATGGGATATAGCAGCAAAGCCATTAGTATAATTGCAGGACAAACCA
rJMSF046G01+ ACTGTCTTTGTGCCATGGGATATAGCAGCAAAGCCATTAGTATAATTGCAGGACAAACCA
rJMSF037D10+ ACTGTCTTTGTGCCATGGGATATAGCAGCAAAGCCATTAGTATAATTGCAGGACAAACCA
rJMSF027N23+ ACTGTCTTTGTGCCATGGGATATAGCAGCAAAGCCATTAGTATAATTGCAGGACAAACCA
JMFS082B11+ ACTGTCTTTGTGCCATGGGATATAGCAGCAAAGCCATTAGTATAATTGCAGGACAAACCA
rJMFF044D02+ ACTGTCTTTGTGCCATGGGATATAGCAGCAAAGCCATTAGTATAATTGCAGGACAAACCA
                      ____________________________________________________________
consensus ACTGTCTTTGTGCCATGGGATATAGCAGCAAAGCCATTAGTATAATTGCAGGACAAACCA
 
. : . : . : . : . : . :
rJMSF020H14+ CATCTTGCCACAAGGGCTTTTCCATTTTGGATGTGAACTTTCCTTCGATAACCATACCAG
rJMFF037J06+ CATCTTGCCACAAGGGCTTTTCCATTTTGGATGTGAACTTTCCTTCGATAACCATACCAG
rJMSF046G01+ CATCTTGCCACAAGGGCTTTTCCATTTTGGATGTGAACTTTCCTTCGATAACCATACCAG
rJMSF037D10+ CATCTTGCCACAAGGGCTTTTCCATTTTGGATGTGAACTTTCCTTCGATAACCATACCAG
rJMSF027N23+ CATCTTGCCACAAGGGCTTTTCCATTTTGGATGTGAACTTTCCTTCGATAACCATACCAG
JMFS082B11+ CATCTTGCCACAAGGGCTTTTCCATTTTGGATGTGAACTTTCCTTCGATAACCATACCAG
rJMFF044D02+ CATCTTGCCACAAGGGCTTTTCCATTTTGGATGTGAACTTTCCTTCGATAACCATACCAG
                      ____________________________________________________________
consensus CATCTTGCCACAAGGGCTTTTCCATTTTGGATGTGAACTTTCCTTCGATAACCATACCAG
 
. : . : . : . : . : . :
rJMSF020H14+ ATTTAAAACGCCCAATCACTCTCACAAGAACTGTGACAAATGTTGGACCTGAAAATTCTA
rJMFF037J06+ ATTTAAAACGCCCAATCACTCTCACAAGAACTGTGACAAATGTTGGACCTGAAAATTCTA
rJMSF046G01+ ATTTAAAACGCCCAATCACTCTCACAAGAACTGTGACAAATGTTGGACCTGAAAATTCTA
rJMSF037D10+ ATTTAAAACGCCCAATCACTCTCACAAGAACTGTGACAAATGTTGGACCTGAAAATTCTA
rJMSF027N23+ ATTTAAAACGCCCAATCACTCTCACAAGAACTGTGACAAATGTTGGACCTGAAAATTCTA
JMFS082B11+ ATTTAAAACGCCCAATCACTCTCACAAGAACTGTGACAAATGTTGGACCTGAAAATTCTA
rJMFF044D02+ ATTTAAAACGCCCAATCACTCTCACAAGAACTGTGACAAATGTTGGACCTGAAAATTCTA
                      ____________________________________________________________
consensus ATTTAAAACGCCCAATCACTCTCACAAGAACTGTGACAAATGTTGGACCTGAAAATTCTA
 
. : . : . : . : . : . :
rJMSF020H14+ CATACAAAGTTATGGTTGAACCTCCAAAAGGAATAATTGTTGTTGTAAAGCCAAGTACAC
rJMFF037J06+ CATACAAAGTTATGGTTGAACCTCCAAAAGGAATAATTGTTGTTGTAAAGCCAAGTACAC
rJMSF046G01+ CATACAAAGTTATGGTTGAACCTCCAAAAGGAATAATTGTTGTTGTAAAGCCAAGTACAC
rJMSF037D10+ CATACAAAGTTATGGTTGAACCTCCAAAAGGAATAATTGTTGTTGTAAAGCCAAGTACAC
rJMSF027N23+ CATACAAAGTTATGGTTGAACCTCCAAAAGGAATAATTGTTGTTGTAAAGCCAAGTACAC
JMFS082B11+ CATACAAAGTTATGGTTGAACCTCCAAAAGGAATAATTGTTGTTGTAAAGCCAAGTACAC
rJMFF044D02+ CATACAAAGTTATGGTTGAACCTCCAAAAGGAATAATTGTTGTTGTAAAGCCAAGTACAC
                      ____________________________________________________________
consensus CATACAAAGTTATGGTTGAACCTCCAAAAGGAATAATTGTTGTTGTAAAGCCAAGTACAC
 
. : . : . : . : . : . :
rJMSF020H14+ TAAACTTCAGTCCTAATGTGAAGAAGATCTCCTTCAACGTAACAATTTCAACGTGCCATG
rJMFF037J06+ TAAACTTCAGTCCTAATGTGAAGAAGATCTCCTTCAACGTAACAATTTCAACGTGCCATG
rJMSF046G01+ TAAACTTCAGTCCTAATGTGAAGAAGATCTCCTTCAACGTAACAATTTCAACGTGCCATG
rJMSF037D10+ TAAACTTCAGTCCTAATGTGAAGAAGATCTCCTTCAACGTAACAATTTCAACGTGCCATG
rJMSF027N23+ TAAACTTCAGTCCTAATGTGAAGAAGATCTCCTTCAACGTAACAATTTCAACGTGCCATG
JMFS082B11+ TAAACTTCAGTCCTAATGTGAAGAAGATCTCCTTCAACGTAACAATTTCAACGTGCCATG
rJMFF044D02+ TAAACTTCAGTCCTAATGTGAAGAAGATCTCCTTCAACGTAACAATTTCAACGTGCCATG
                      ____________________________________________________________
consensus TAAACTTCAGTCCTAATGTGAAGAAGATCTCCTTCAACGTAACAATTTCAACGTGCCATG
 
. : . : . : . : . : . :
rJMSF020H14+ GTTTCAACACAGGATTCTATTTTGGGAGCTTAATTTGGAATGATGGGGTGCATAATGTGA
rJMFF037J06+ GTTTCAACACAGGATTCTATTTTGGGAGCTTAATTTGGAATGATGGGGTGCATAATGTGA
rJMSF046G01+ GTTTCAACACAGGATTCTATTTTGGGAGCTTAATTTGGAATGATGGGGTGCATAATGTGA
rJMSF037D10+ GTTTCAACACAGGATTCTATTTTGGGAGCTTAATTTGGAATGATGGGGTGCATAATGTGA
rJMSF027N23+ GTTTCAACACAGGATTCTATTTTGGGAGCTTAATTTGGAATGATGGGGTGCATAATGTGA
JMFS082B11+ GTTTCAACACAGGATTCTATTTTGGGAGCTTAATTTGGAATGATGGGGTGCATAATGTGA
rJMFF044D02+ GTTTCAACACAGGATTCTATTTTGGGAGCTTAATTTGGAATGATGGGGTGCATAATGTGA
                      ____________________________________________________________
consensus GTTTCAACACAGGATTCTATTTTGGGAGCTTAATTTGGAATGATGGGGTGCATAATGTGA
 
. : . : . : . : . : . :
rJMSF020H14+ GAATTCCTATATCTGTCAAGACTAAGTATTAAGAATCTTAAATTGGTGCTTGTTAAGATT
rJMFF037J06+ GAATTCCTATATCTGTCAAGACTAAGTATTAAGAATCTTAAATTGGTGCTTGTTAAGAT
rJMSF046G01+ GAATTCCTATATCTGTCAAGACTAAGTATTAAGAATCTTAAATTGGTGCTTGTTAAGATT
rJMSF037D10+ GAATTCCTATATCTGTCAAGACTAAGTATTAAGAATCTTAAATTGGTGCTTGTTAAGATT
rJMSF027N23+ GAATTCCTATATCTGTCAAGACTAAGTATTAAGAATCTTAAATTGGTGCTTGTTAAGATT
JMFS082B11+ GAATTCCTATATCTGTCAAGACTAAGTATTAAGAATCTTAAATTGGTGCTTGTTAAGATT
rJMFF044D02+ GAATTCCTATATCTGTCAAGACTAAGTATTAAGAATCTTAAATTGGTGCTTGTTAAGATT
                      ____________________________________________________________
consensus GAATTCCTATATCTGTCAAGACTAAGTATTAAGAATCTTAAATTGGTGCTTGTTAAGATT
 
. : . : . : . : . : . :
rJMSF020H14+ GTTTTAAGAATAAATAAGCATTAAGTTATTTGCATTGTATAGACTATTGTGC
rJMSF046G01+ GTTTTAAGAATAAATAAGCATTAAGTTATTTGCATTGTATAGACTATTGTGCAT
rJMSF037D10+ GTTTTAAGAATAAATAAGCATTAAGTTATTTGCATTGTATAGACTATTGTGCATGTAT
rJMSF027N23+ GTTTTAAGAATAAATAAGCATTAAGTTATTTGCATTGTATAGACTATTGTGCATGTAT
JMFS082B11+ GTTTTAAGAATAAATAAGCATTAAGTTATTTGCATTGTATAGACTATTGTGCATGTATTT
rJMFF044D02+ GTTTTAAGAATAAATAAGCATTAAGTTATTTGCATTGTATAGACTATTGTGCATGTATTT
                      ____________________________________________________________
consensus GTTTTAAGAATAAATAAGCATTAAGTTATTTGCATTGTATAGACTATTGTGCATGTATTT
 
. : . : . : . : . : . :
JMFS082B11+ AAATTTTCTCTTGTGAGTGAAAAA
rJMFF044D02+ AAATTTTCTCTTGTGAGTGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AAATTTTCTCTTGTGAGTGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG