Previous Contig 010402:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF023I12Sequence458001178 (4)719010402 (5)gb:CAR276270_16452114e-31Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can101-1.
JMFF024K04Sequence528001178 (4)gb:AC097112_17364311e-04Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1741_B01, complete s765010402 (5)gb:CAR276270_16452112e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can101-1.
JMFF035H15Sequence552001178 (4)gb:AC097112_17364312e-07Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1741_B01, complete s669010402 (5)gb:CAR276270_16452119e-30Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can101-1.
JMFF044C23Sequence636001178 (4)gb:AC097112_17364311e-23Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1741_B01, complete s592010402 (5)gb:CAR276270_16452114e-22Cicer arietinum partial mRNA for hypothetical protein (ORF1), clone Can101-1.
JMFN037E07Sequence208010402 (5)gb:AC097112_17364313e-17Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1741_B01, complete s

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF024K04+ GGTTCGCGAGCAAGTAGTTGTTGATT
                      ____________________________________________________________
consensus GGTTCGCGAGCAAGTAGTTGTTGATT
 
. : . : . : . : . : . :
rJMFF024K04+ CTTCAGACCTGACTACTGACTNTAAGATTGAAGTTGACGAATTGGCTGTGATTGAACCCT
                      ____________________________________________________________
consensus CTTCAGACCTGACTACTGACTNTAAGATTGAAGTTGACGAATTGGCTGTGATTGAACCCT
 
. : . : . : . : . : . :
rJMFF035H15+ AGTTGATGACAATCCAGTAGATGTATTGCAGAATCATATCCCCT
rJMFF024K04+ CTCCAAAACCTTCTACAGTTGATGACAATCCAGTAGATGTATTGCAGAATCATAT-CCCT
rJMFF023I12+ AGTTGATGACAATCCAGTAGATGTATTGCAGAATCATAT-CCCT
                      ____________________________________________________________
consensus CTCCAAAACCTTCTACAGTTGATGACAATCCAGTAGATGTATTGCAGAATCATAT-CCCT
 
. : . : . : . : . : . :
rJMFF035H15+ GTTGAACAGTTGCTGCCTGAAAATGGTGAGAGGGGCGAGACAATACCCGCAGTAATGGAG
rJMFF024K04+ GTTGAACAGTTGCTGCCTGAAAATGGTGAGAGGGGCGAGACAATACCCGCAGTAATGGAG
rJMFF023I12+ GTTGAACAGTTGCTGCCTGAAAATGGTGAGAGGGGCGAGACAATACCCGCAGTAATGGAG
                      ____________________________________________________________
consensus GTTGAACAGTTGCTGCCTGAAAATGGTGAGAGGGGCGAGACAATACCCGCAGTAATGGAG
 
. : . : . : . : . : . :
rJMFF035H15+ GAACTTACCTCCAAGGAGGATCAAACTAGCAAGGAAAGCCAGAGAACTAGGAGAAGGAGA
rJMFF024K04+ GAACTTACCTCCAAGGAGGATCAAACTAGCAAGGAAAGCCAGAGAACTAGGAGAAGGAGA
rJMFF023I12+ GAACTTACCTCCAAGGAGGATCAAACTAGCAAGGAAAGCCAGAGAACTAGGAGAAGGAGA
                      ____________________________________________________________
consensus GAACTTACCTCCAAGGAGGATCAAACTAGCAAGGAAAGCCAGAGAACTAGGAGAAGGAGA
 
. : . : . : . : . : . :
rJMFF035H15+ TCTCTTCCAGCAAAGCAGGAACAGACTGAAAATATTTCACAAAATGCACCAAGCTTGCCT
rJMFF024K04+ TCTCTTCCAGCAAAGCAGGAACAGACTGAAAATATTTCACAAAATGCACCAAGCTTGCCT
JMFN037E07- ATTTCACAAAATGCACCAAGCTTGCCT
rJMFF023I12+ TCTCTTCCAGCAAAGCAGGAACAGACTGAAAATATTTCACAAAATGCACCAAGCTTGCCT
rJMFF044C23+ CAGCAAAGCATGAACAGACTGAAAAT-TTTCACAAAATGCACCAAGCTTGCCT
                      ____________________________________________________________
consensus TCTCTTCCAGCAAAGCAGGAACAGACTGAAAATATTTCACAAAATGCACCAAGCTTGCCT
 
. : . : . : . : . : . :
rJMFF035H15+ AGCTATATGGCAGCGACTGAATCTGCAAAGGCTAAGCTTAAAGCACAGGGAACTACTAGA
rJMFF024K04+ AGCTATATGGCAGCGACTGAATCTGCAAAGGCTAAGCTTAAAGCACAGGGAACTACTAGA
JMFN037E07- AGCTATATGGCAGCGACTGAATCTGCAAAGGCTAAGCTTAAAGCACAGGGAACTACTAGA
rJMFF023I12+ AGCTATATGGCAGCGACTGAATCTGCAAAGGCTAAGCTTAAAGCACAGGGAACTACTAGA
rJMFF044C23+ AGCTATATGGCAGCGACTGAATCTGCAAAGGCTAAGCTTAAAGCACAGGGAACTACTAGA
                      ____________________________________________________________
consensus AGCTATATGGCAGCGACTGAATCTGCAAAGGCTAAGCTTAAAGCACAGGGAACTACTAGA
 
. : . : . : . : . : . :
rJMFF035H15+ TCTACTGAAGATGAGGCTGAAAATGGATTTGTCAGACGGCATTCACTACCATCCTTGACC
rJMFF024K04+ TCTACTGAAGATGAGGCTGAAAATGGATTTGTCAGACGGCATTCACTACCATCCTTGACC
JMFN037E07- TCTACTGAAGATGAGGCTGAAAATGGATTTGTCAGACGGCATTCACTACCATCCTTGACC
rJMFF023I12+ TCTACTGAAGATGAGGCTGAAAATGGATTTGTCAGACGGCATTCACTACCATCCTTGACC
rJMFF044C23+ TCTACTGAAGATAAGGCTGAAAATGGATTTGTCAGACGGCATTCACTACCATCCTTGACC
                      ____________________________________________________________
consensus TCTACTGAAGATGAGGCTGAAAATGGATTTGTCAGACGGCATTCACTACCATCCTTGACC
 
. : . : . : . : . : . :
rJMFF035H15+ AAAGGAAAACTCAACTCACTGTCTCCTCGGGTGCAGCGGCCAGTGCAAGCAAATGGCAAA
rJMFF024K04+ AAAGGAAAACTCAACTCACTGTCTCCTCGGGTGCAGCGGCCAGTGCAAGCAAATGGCAAA
JMFN037E07- AATGGAAAACTCAACTCACTGTCTCCTCGGGTGCAGCGGCCAGTGCAAGCAAATGGCAAA
rJMFF023I12+ AATGGAAAACTCAACTCACTGTCTCCTCGGGTGCAGCGGCCAGTGCAAGCAAATGGCAAA
rJMFF044C23+ AATGGAAAACTCAACTCACTGTCTCCTCGGGTGCAGCGGCCAGTGCAAGCAAATGGCAAA
                      ____________________________________________________________
consensus AATGGAAAACTCAACTCACTGTCTCCTCGGGTGCAGCGGCCAGTGCAAGCAAATGGCAAA
 
. : . : . : . : . : . :
rJMFF035H15+ GGAGGAAACAAACCCAACAGATCAGTGTCTTCCACTAGAGATGAAAAGGCGCTTCAGCCT
rJMFF024K04+ GGAGGAAACAAACCCAACAGATCAGTGTCTTCCACTAGAGATGAAAAGGCGCTTCAGCCT
JMFN037E07- G
rJMFF023I12+ GGAGGAAACAAACCCAACAGATCAGTGTCTTCCACTAGAGATGAAAAGGCGCTTCAGCCT
rJMFF044C23+ GGAGGAAACAAACCCAACAGATCAGTGTCTTCCACTAGAGATGAAAAGGCGCTTCAGCCT
                      ____________________________________________________________
consensus GGAGGAAACAAACCCAACAGATCAGTGTCTTCCACTAGAGATGAAAAGGCGCTTCAGCCT
 
. : . : . : . : . : . :
rJMFF035H15+ GGTTGGAGGAGATGAGTTCAAGAATCCTCTCACCGGAGTGTGGAGGTCCATTGTGAGGCT
rJMFF024K04+ GGTTGGAGGAGATGAGTTCAAGAATCCTCTCACCGGAGTGTGGAGGTCCATTGTGAGGCT
rJMFF023I12+ GGTTGGAGGAGATGAGTTCAAGAATCCTCTCACCGGAGTGTGGAGGTCCATTGTGAGGCT
rJMFF044C23+ GGTTGGAGGAGATGAGTTCAAGAATCCTCTCACCGGAGTGTGGAGGTCCATTGTGAGGCT
                      ____________________________________________________________
consensus GGTTGGAGGAGATGAGTTCAAGAATCCTCTCACCGGAGTGTGGAGGTCCATTGTGAGGCT
 
. : . : . : . : . : . :
rJMFF035H15+ GTTTCATTTGGTTGTGCAATCTCTGTTGTGTAAAAGATTAGACTGAACTTAGCTTAATAT
rJMFF024K04+ GTTTCATTTGGTTGTGCAATCTCTGTTGTGTAAAAGATTAGACTGAACTTAGCTTAATAT
rJMFF023I12+ GTTTCATTTGGTTGTGCAATCTCTGTTGTGTAAAAGATTAGACTGAACTTAGCTTAATAT
rJMFF044C23+ GTTTCATTTGGTTGTGCAATCTCTGTTGTGTAAAAGATTAGACTGAACTTAGCTTAATAT
                      ____________________________________________________________
consensus GTTTCATTTGGTTGTGCAATCTCTGTTGTGTAAAAGATTAGACTGAACTTAGCTTAATAT
 
. : . : . : . : . : . :
rJMFF035H15+ AATTTGTGTCACTCCCAGGCTTCCCATCATAGGCTTGGACTGTTAAAAGGGGAATGTATA
rJMFF024K04+ AATTTGTGTCACTCCCAGGCTTCCCATCATAGGCTTGGACTGTTAAAAGGGGAATGTATA
rJMFF023I12+ AATTTGTGTCACTCCCAGGCTTCCCATCATAGGCTTGGACTGTTAAAAGGGGAATGTATA
rJMFF044C23+ AATTTGTGTCACTCCCAGGCTTCCCATCATAGGCTTGGACTGTTAAAAGGGGAATGTATA
                      ____________________________________________________________
consensus AATTTGTGTCACTCCCAGGCTTCCCATCATAGGCTTGGACTGTTAAAAGGGGAATGTATA
 
. : . : . : . : . : . :
rJMFF035H15+ GCGATAGACTCCGAGAGAAT
rJMFF024K04+ GCGATAGACTCCGAGAGAAT
rJMFF023I12+ GCGATAGACTCCGAGAGAATGTCATTTTACAGTTGGTGTGCTGTTTTTTGTTTCTGTTTT
rJMFF044C23+ GCGATAGACTCCGAGAGAATGTCATTTTACAGTTGGTGTGCTGTTTTTTGTTTCTGTTTT
                      ____________________________________________________________
consensus GCGATAGACTCCGAGAGAATGTCATTTTACAGTTGGTGTGCTGTTTTTTGTTTCTGTTTT
 
. : . : . : . : . : . :
rJMFF023I12+ GTAATGTGCAGATGCT
rJMFF044C23+ GTAATGTGCAGATGCTTGACTCATGAATCTCTTGCTACAGGTTTGCTGTGTGTTTTTTTT
                      ____________________________________________________________
consensus GTAATGTGCAGATGCTTGACTCATGAATCTCTTGCTACAGGTTTGCTGTGTGTTTTTTTT