Previous Contig 010391:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007O09Sequence324000405 (4)278010391 (2)
JMFF044B14Sequence649000405 (4)gb:AF428307_17992371e-22Arabidopsis thaliana At1g70780/F5A18_4 mRNA, complete cds.646010391 (2)pir|D96732|D967329e-11hypothetical protein F15H11.3 [imported] - Arabidopsis thaliana>gb:AE005173_8946

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF044B14+ TATATAAAATAGGAATGTATAAGCCTCACTATATGCCTTTCTGGGAC
                      ____________________________________________________________
consensus TATATAAAATAGGAATGTATAAGCCTCACTATATGCCTTTCTGGGAC
 
. : . : . : . : . : . :
rJMFF044B14+ GGCCCCGATTTGGGCGACTCGGGTGCCTAGGCCGCTTAGTCGGCCCAGAAGGGTAAAATT
                      ____________________________________________________________
consensus GGCCCCGATTTGGGCGACTCGGGTGCCTAGGCCGCTTAGTCGGCCCAGAAGGGTAAAATT
 
. : . : . : . : . : . :
rJMFF044B14+ GTCTGGGTCGATTTTTACAACACTGTTTCTGTATTTTGTTTTATGCATATCTATTGATAA
                      ____________________________________________________________
consensus GTCTGGGTCGATTTTTACAACACTGTTTCTGTATTTTGTTTTATGCATATCTATTGATAA
 
. : . : . : . : . : . :
rJMFF044B14+ CATTGTTGTGAAATTTGTAGCTCTTAGTCCATGGGACACAATTGGATCACTGGGGGTTCG
                      ____________________________________________________________
consensus CATTGTTGTGAAATTTGTAGCTCTTAGTCCATGGGACACAATTGGATCACTGGGGGTTCG
 
. : . : . : . : . : . :
rJMFF044B14+ AAACTTTGTGCTGTGCAAGAAGCCGGCGGAGGAGAAAGCAACTTCCGGCGATGGGAAACA
                      ____________________________________________________________
consensus AAACTTTGTGCTGTGCAAGAAGCCGGCGGAGGAGAAAGCAACTTCCGGCGATGGGAAACA
 
. : . : . : . : . : . :
rJMFF007O09+ GAGGCGGTGGCGGCTCNGAAGTCGGGCAGCATNTGGAAGACATTGTTCAACAA
rJMFF044B14+ GGCGGCCGAGGCGGTGGCGGCTCGGAAGTCGGGCAGCATCTGGAAGACATTGTTCAACAA
                      ____________________________________________________________
consensus GGCGGCCGAGGCGGTGGCGGCTCGGAAGTCGGGCAGCATCTGGAAGACATTGTTCAACAA
 
. : . : . : . : . : . :
rJMFF007O09+ GTCACNGAATGCCAAGGTTATGTNTCATNGAGGTGGTGGGATGGTTCACTCAAAATCCCA
rJMFF044B14+ GTCACTGAATGCCAAGGTTATGTCTCATTGAGGTGGTGGGATGGTTCACTCAAAATCCCA
                      ____________________________________________________________
consensus GTCACTGAATGCCAAGGTTATGTCTCATTGAGGTGGTGGGATGGTTCACTCAAAATCCCA
 
. : . : . : . : . : . :
rJMFF007O09+ AGATTATGTCTCATNGGAGTGAAGTGCAATAAAACATTCTGTTAGGCAGTTACTGATTGT
rJMFF044B14+ AGATTATGTCTCATTGGAGTGAAGTGCAATAAAACATTCTGTTAGGCAGTTACTGATTGT
                      ____________________________________________________________
consensus AGATTATGTCTCATTGGAGTGAAGTGCAATAAAACATTCTGTTAGGCAGTTACTGATTGT
 
. : . : . : . : . : . :
rJMFF007O09+ CTTAGGTTGTCTCTTGGATTTGTTGTTTTTGAGGTTTTTGCAATTAGCTTTAATTTGATT
rJMFF044B14+ CTTAGGTTGTCTCTTGGATTTGTTGTTTTTGAGGTTTTTGCAATTAGCTTTAATTTGATT
                      ____________________________________________________________
consensus CTTAGGTTGTCTCTTGGATTTGTTGTTTTTGAGGTTTTTGCAATTAGCTTTAATTTGATT
 
. : . : . : . : . : . :
rJMFF007O09+ TGATCTGATTTANGATTCAGAACTAGTATGCAATGTATTGTT
rJMFF044B14+ TGATCTGATTTATGATTCAGAACTAGTAT-CAATGTATTGTTGTTACCATTCTATTGTTA
                      ____________________________________________________________
consensus TGATCTGATTTATGATTCAGAACTAGTATGCAATGTATTGTTGTTACCATTCTATTGTTA
 
. : . : . : . : . : . :
rJMFF044B14+ TTGTTCAATAAAAGCTTAAAGTTTTAGACCTTAAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus TTGTTCAATAAAAGCTTAAAGTTTTAGACCTTAAAAAAAAAAAAAAAAACTCTCCAGGGT