Previous Contig 010387:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044B05Sequence630010387 (2)gb:AB026639_15170922e-18Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L13.>gb:AY086493_15619010387 (2)gb:AB026639_15170925e-08Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K21L13.>gb:AY086493_15

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044B05- GCCATTTCCAAGCTTCCTTATCTCCGTTTTCTGCAGAA
                      ____________________________________________________________
consensus GCCATTTCCAAGCTTCCTTATCTCCGTTTTCTGCAGAA
 
. : . : . : . : . : . :
JMFF044B05- GCAATTTCAGTTATTTTAATTTTTCTGTTTTCTGAGCCCTTTGGATGAGGGAAGAAGAAG
                      ____________________________________________________________
consensus GCAATTTCAGTTATTTTAATTTTTCTGTTTTCTGAGCCCTTTGGATGAGGGAAGAAGAAG
 
. : . : . : . : . : . :
JMFF044B05- GGGTATCGGGAAATATAAGGAATTGTTGTTGGGATAGAAGCGATGGAGAGTCCATATTCA
                      ____________________________________________________________
consensus GGGTATCGGGAAATATAAGGAATTGTTGTTGGGATAGAAGCGATGGAGAGTCCATATTCA
 
. : . : . : . : . : . :
JMFF044B05- GCGCCGCCGCATGTGGATGCGTCTCGGCCGTCACTGGGCTTCCCTCTCGGCACCGCGCTG
                      ____________________________________________________________
consensus GCGCCGCCGCATGTGGATGCGTCTCGGCCGTCACTGGGCTTCCCTCTCGGCACCGCGCTG
 
. : . : . : . : . : . :
JMFF044B05- CTCTTGATCGTCATCTTCACCTTGAGCGGCGTATTCTCCTGCTGTTACCACTGGGACAAG
                      ____________________________________________________________
consensus CTCTTGATCGTCATCTTCACCTTGAGCGGCGTATTCTCCTGCTGTTACCACTGGGACAAG
 
. : . : . : . : . : . :
JMFF044B05- CTCCGATCCCTCCGTCGGTCTTTCGCCGACGGCTCGCCCGCCGACGGTGATGATGGGCCC
rJMFF044B05+ CGACGGTGATGATGGGCCC
                      ____________________________________________________________
consensus CTCCGATCCCTCCGTCGGTCTTTCGCCGACGGCTCGCCCGCCGACGGTGATGATGGGCCC
 
. : . : . : . : . : . :
JMFF044B05- CGCAAGCCTGTACTCGCACAACCGGTAACAATTCCCTCTCCGATATAGCCGCACAGAACC
rJMFF044B05+ CGCAAGCCTGTACTCGCACAACCGGTAACAATTCCCTCTCCGATATAGCCGCACAGAACC
                      ____________________________________________________________
consensus CGCAAGCCTGTACTCGCACAACCGGTAACAATTCCCTCTCCGATATAGCCGCACAGAACC
 
. : . : . : . : . : . :
JMFF044B05- AAAATTAGTGATTTGTTTATGGGAAATGATTAAAATTGGTTTGTTTTGTTTCACTTTGCA
rJMFF044B05+ AAAATTAGTGATTTGTTTATGGGAAATGATTAAAATTGGTTTGTTTTGTTTCACTTTGCA
                      ____________________________________________________________
consensus AAAATTAGTGATTTGTTTATGGGAAATGATTAAAATTGGTTTGTTTTGTTTCACTTTGCA
 
. : . : . : . : . : . :
JMFF044B05- GGATTTGAAGCAAAATCAGAGCTTGACTTTGCCGGTGGTAATGCCGGGCGAACATGTGCC
rJMFF044B05+ GGATTTGAAGCAAAATCAGAGCTTGACTTTGCCGGTGGTAATGCCGGGCGAACATGTGCC
                      ____________________________________________________________
consensus GGATTTGAAGCAAAATCAGAGCTTGACTTTGCCGGTGGTAATGCCGGGCGAACATGTGCC
 
. : . : . : . : . : . :
JMFF044B05- CAGGTTCTTGGCATTGCCGTGTCCCTGTCAGCCGCGGCGGGAGGAGAGGATCGTTGTGGA
rJMFF044B05+ CAGGTTCTTGGCATTGCCGTGTCCCTGTCAACCGCGGCGGGAGGAGAGGATCGTTGTGGA
                      ____________________________________________________________
consensus CAGGTTCTTGGCATTGCCGTGTCCCTGTCAGCCGCGGCGGGAGGAGAGGATCGTTGTGGA
 
. : . : . : . : . : . :
JMFF044B05- GGTGCAGAAGCCTCCGCCTCCGCCGCCGAAACCTCTCCGGNGACCTGAAGCG
rJMFF044B05+ GGTGCAGAAGCCTCCGCCTCCGCCGCCGAAACCTTTCCGGGGACCTGAAGCGGTGCCGTT
                      ____________________________________________________________
consensus GGTGCAGAAGCCTCCGCCTCCGCCGCCGAAACCTTTCCGGGGACCTGAAGCGGTGCCGTT
 
. : . : . : . : . : . :
rJMFF044B05+ TTTTTAGACCGGCAACCGGAACACGCAATTGGGAATCGGAAAATTCCCTTCTTTCGCCGG
                      ____________________________________________________________
consensus TTTTTAGACCGGCAACCGGAACACGCAATTGGGAATCGGAAAATTCCCTTCTTTCGCCGG
 
. : . : . : . : . : . :
rJMFF044B05+ AATCGGAACAGACAGGTCTCATCGTTGTTGATTCTCGAGGATACGGCGAAAGATTTCGGT
                      ____________________________________________________________
consensus AATCGGAACAGACAGGTCTCATCGTTGTTGATTCTCGAGGATACGGCGAAAGATTTCGGT
 
. : . : . : . : . : . :
rJMFF044B05+ ATTTCACTGTCGGAAGCTGACCGTTCACTTCACCAAGAGGTAGTCXXXXXXXXXXXXXXX
                      ____________________________________________________________
consensus ATTTCACTGTCGGAAGCTGACCGTTCACTTCACCAAGAGGTAGTCNNNNNNNNNNNNNNN
 
. : . : . : . : . : . :
rJMFF044B05+ XXXXXXXXXXGTCTTTCTTCTTTTTCTTATTNGTATATACGAATTTGTTCTTTTTAAGAA
                      ____________________________________________________________
consensus NNNNNNNNNNGTCTTTCTTCTTTTTCTTATTNGTATATACGAATTTGTTCTTTTTAAGAA
 
. : . : . : . : . : . :
rJMFF044B05+ AACAATTAATGCAGACATTTGATTCAGTGTTCGAAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus AACAATTAATGCAGACATTTGATTCAGTGTTCGAAAAAAAAAAAAAAAACTCTCCAGGGT