Previous Contig 010385:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF026J01Sequence496001253 (3)pir|A96709|A967091e-18unknown protein, 35272-36292 [imported] - Arabidopsis thaliana>gb:AE005173_89447246010385 (2)
JMFF044A22Sequence621001253 (3)pir|A96709|A967091e-12unknown protein, 35272-36292 [imported] - Arabidopsis thaliana>gb:AE005173_89447537010385 (2)pir|A96709|A967092e-05unknown protein, 35272-36292 [imported] - Arabidopsis thaliana>gb:AE005173_89447

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF044A22+ TTTTGGCAACAAACCGGCAGTGAGAATCGAGGGTTTTGATTTCCTGGACAGGGATCG
                      ____________________________________________________________
consensus TTTTGGCAACAAACCGGCAGTGAGAATCGAGGGTTTTGATTTCCTGGACAGGGATCG
 
. : . : . : . : . : . :
rJMFF044A22+ CAGGAAATGCAGCATCCCTGCACTGGCCTGAACCCAAAACCTTAAAATCCCCCAATTCCC
                      ____________________________________________________________
consensus CAGGAAATGCAGCATCCCTGCACTGGCCTGAACCCAAAACCTTAAAATCCCCCAATTCCC
 
. : . : . : . : . : . :
rJMFF026J01+ AAAAAAAAAAAAACAAGAGAACAAGGCAGATTAAGTAAATAGTGAGTCCATTAGCAGCA
rJMFF044A22+ CAAAAAAAAAAAAACAAGGGAACAAGGCCGGTTAAGTAAATAGTGAGTCCCTTAGCAGCA
                      ____________________________________________________________
consensus CAAAAAAAAAAAAACAAGGGAACAAGGCCGGTTAAGTAAATAGTGAGTCCCTTAGCAGCA
 
. : . : . : . : . : . :
rJMFF026J01+ GCAAAAAACAAGAAGAAGAATTTTTAGCAATTTCCAGATGAGATGATGAGTGAGTGAAAA
rJMFF044A22+ GCAAAAAACAAGAAGAAGGATTTTTAGCAATTTCCAGATGAGATGATGAGTGAGTGAAAA
                      ____________________________________________________________
consensus GCAAAAAACAAGAAGAAGGATTTTTAGCAATTTCCAGATGAGATGATGAGTGAGTGAAAA
 
. : . : . : . : . : . :
rJMFF026J01+ GCAGCATGATATATGATCCCTTTTGCACAGTGTAAATATGTTTAGAGGGCTGTGTTGTGC
rJMFF044A22+ ACAGCCTGATATATGATCCCTTTTGCCCAGGGTAAATATGTTTAGAGGGCTGTGTTGTGC
                      ____________________________________________________________
consensus GCAGCCTGATATATGATCCCTTTTGCCCAGTGTAAATATGTTTAGAGGGCTGTGTTGTGC
 
. : . : . : . : . : . :
rJMFF026J01+ CTGTAAGTATGATGATTATGAGAGGAGTTTAGGATTTTA
rJMFF044A22+ CCGTAAGTATGATGATTTTGAGAGGAGTTTAGGATTTTAATGATAATATTTAGTTGGGAG
                      ____________________________________________________________
consensus CTGTAAGTATGATGATTTTGAGAGGAGTTTAGGATTTTAATGATAATATTTAGTTGGGAG
 
. : . : . : . : . : . :
rJMFF044A22+ CAAAAATCCCTTTTTGTGATGTAAGTATGAATGAGGGGCGGAGGGTTTTTGAAGATTTGT
                      ____________________________________________________________
consensus CAAAAATCCCTTTTTGTGATGTAAGTATGAATGAGGGGCGGAGGGTTTTTGAAGATTTGT
 
. : . : . : . : . : . :
rJMFF044A22+ GTCCATTTTGTAGACTTTGTGTTGCAGAAATTTTGTGAAGAAAAAGTGTAGTTTGGTGTT
                      ____________________________________________________________
consensus GTCCATTTTGTAGACTTTGTGTTGCAGAAATTTTGTGAAGAAAAAGTGTAGTTTGGTGTT
 
. : . : . : . : . : . :
rJMFF044A22+ TTGAGTCCCCCGTACTCATTTCCCTTTTTAAATGGAATATAATACAGAGTTTTTTTTTGG
                      ____________________________________________________________
consensus TTGAGTCCCCCGTACTCATTTCCCTTTTTAAATGGAATATAATACAGAGTTTTTTTTTGG