Previous Contig 010384:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003K02Sequence486010384 (12)gb:AY085268_15703405e-39Arabidopsis thaliana clone 142216 mRNA, complete sequence.788010384 (12)gb:AY085268_15703405e-66Arabidopsis thaliana clone 142216 mRNA, complete sequence.
JMFF004A10Sequence355010384 (12)797010384 (12)gb:AY085268_15703407e-68Arabidopsis thaliana clone 142216 mRNA, complete sequence.
JMFF007P10Sequence123010384 (12)772010384 (12)gb:AY085268_15703401e-71Arabidopsis thaliana clone 142216 mRNA, complete sequence.
JMFF007P21Sequence622010384 (12)gb:AY085268_15703407e-44Arabidopsis thaliana clone 142216 mRNA, complete sequence.765010384 (12)gb:AY085268_15703403e-69Arabidopsis thaliana clone 142216 mRNA, complete sequence.
JMFF037E09Sequence646010384 (12)gb:AY085268_15703402e-38Arabidopsis thaliana clone 142216 mRNA, complete sequence.787010384 (12)gb:AY085268_15703402e-67Arabidopsis thaliana clone 142216 mRNA, complete sequence.
JMFF044A20Sequence628010384 (12)gb:AY085268_15703408e-36Arabidopsis thaliana clone 142216 mRNA, complete sequence.612010384 (12)gb:AY085268_15703402e-63Arabidopsis thaliana clone 142216 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF004A10- ATCTCTCCTTTT
                      ____________________________________________________________
consensus ATCTCTCCTTTT
 
. : . : . : . : . : . :
JMFF007P10- GTTAGTCAATTCCTCACGTTCAGCCAAAGTAATATTCAACGCCGAGTCTCATTAC
JMFF004A10- TTTCCGTTAGTCAATTCCTCACGTTCAGCCAAAGTAATATTCAACGCCGAGTCTCATTAC
JMFF007P21- GTTAGTCAATTCCTCACGTTCAGCCAAAGTAATATTCAACGCCGAGTCTCATTAC
JMFF044A20- GTTAGTCAATTCCTCACGTTCAGCCAAAGTAATATTCAACGCCGAGTCTCATTAC
JMFF037E09- GTTAGTCAATTCCTCACGTTCAGCCAAAGTAATATTCAACGCCGAGTCTCATTAC
                      ____________________________________________________________
consensus TTTCCGTTAGTCAATTCCTCACGTTCAGCCAAAGTAATATTCAACGCCGAGTCTCATTAC
 
. : . : . : . : . : . :
JMFF007P10- CTTATCGTCTACCTTTTCCTTTTCTATCGACTGANCTGAAAATCAAAATTCTCAAANCTC
JMFF004A10- CTTATCGTCTACCTTTTCCTTTTCTATCGACTGAACTGAAAATCAAAATTCTCAAAGCTC
JMFF007P21- CTTATCGTCTACCTTTTCCTTTTCTATCGACTGAACTGAAAATCAAAATTCTCAAAGCTC
JMFF044A20- CTTATCGTCTACCTTTTCCTTTTCTATCGACTGAACTGAAAATCAAAATTCTCAAAGCTC
JMFF037E09- CTTATCGTCTACCTTTTCCTTTTCTATCGACTGAACTGAAAATCAAAATTCTCAAAGCTC
                      ____________________________________________________________
consensus CTTATCGTCTACCTTTTCCTTTTCTATCGACTGAACTGAAAATCAAAATTCTCAAAGCTC
 
. : . : . : . : . : . :
JMFF007P10- G
JMFF004A10- GTTTAATACTTTCATCCCGCTGAGATCATAGCTTTTCTGCTTCATCGCGACCTGATCACC
JMFF007P21- GTTTAATACTTTCATCCCGCTGAGATCATAGCTTTTCTGCTTCATCGCGACCTGATCACC
JMFF044A20- GTTTAATACTTTCATCCCGCTGAGATCATAGCTTTTCTGCTTCATCGCGACCTGATCACC
JMFF003K02- GCTTTTCTGCTTCATCGCGACCTGATCACC
JMFF037E09- GTTTAATACTTTCATCCCGCTGAGATCATAGCTTTTCTGCTTCATCGCGACCTGATCACC
                      ____________________________________________________________
consensus GTTTAATACTTTCATCCCGCTGAGATCATAGCTTTTCTGCTTCATCGCGACCTGATCACC
 
. : . : . : . : . : . :
JMFF004A10- GGGCAAGGCAACCCGACCTCGTTTTCCCTCGATCGGGTCGCCCGGCAATGTCGGCGACCA
JMFF007P21- GGGCAAGGCAACCCGACCTCGTTTTCCCTCGATCGGGTCGCCCGGCAATGTCGGCGACCA
JMFF044A20- GGGCAAGGCAACCCGACCTCGTTTTCCCTCGATCGGGTCGCCCGGCAATGTCGGCGACCA
JMFF003K02- GGGCAAGGCAACCCGACCTCGTTTTCCCTCGATCGGGTCGCCCGGCAATGTCGGCGACCA
JMFF037E09- GGGCAAGGCAACCCGACCTCGTTTTCCCTCGATCGGGTCGCCCGGCAATGTCGGCGACCA
                      ____________________________________________________________
consensus GGGCAAGGCAACCCGACCTCGTTTTCCCTCGATCGGGTCGCCCGGCAATGTCGGCGACCA
 
. : . : . : . : . : . :
JMFF004A10- AACCCAAAGCTTCAGTAACGAATCCGAATGCGAACACAAGCCCAAAGATCTGGCTTTTTT
JMFF007P21- AACCCAAAGCTTCAGTAACGAATCCGAATGCGAACACAAGCCCAAAGATCTGGCTTTTTT
JMFF044A20- AACCCAAAGCTTCAGTAACGAATCCGAATGCGAACACAAGCCCAAAGATCTGGCTTTTTT
JMFF003K02- AACCCAAAGCTTCAGTAACGAATCCGAATGCGAACACAAGCCCAAAGATCTGGCTTTTTT
JMFF037E09- AACCCAAAGCTTCAGTAACGAATCCGAATGCGAACACAAGCCCAAAGATCTGGCTTTTTT
                      ____________________________________________________________
consensus AACCCAAAGCTTCAGTAACGAATCCGAATGCGAACACAAGCCCAAAGATCTGGCTTTTTT
 
. : . : . : . : . : . :
JMFF004A10- CGCTACTGCTCACCCTCCAGTATGGCTTTCAGCCACTCATCTC
JMFF007P21- CGCTACTGCTCACCCTCCAGTATGGCTTTCAGCCACTCATCTCCAAACGCTTTGTCAGCC
JMFF044A20- CGCTACTGCTCACCCTCCAGTATGGCTTTCAGCCACTCATCTCCAAACGCTTTGTCAGCC
JMFF003K02- CGCTACTGCTCACCCTCCAGTATGGCTTTCAGCCACTCATCTCCAAACGCTTTGTCAGCC
JMFF037E09- CGCTACTGCTCACCCTCCAGTATGGCTTTCAGCCACTCATCTCCAAACGCTTTGTCAGCC
                      ____________________________________________________________
consensus CGCTACTGCTCACCCTCCAGTATGGCTTTCAGCCACTCATCTCCAAACGCTTTGTCAGCC
 
. : . : . : . : . : . :
JMFF007P21- GAGAGGTGATTGTAACTTCATCTGTTTTAGCATGTGAATTAGTCAAGGTTAGTTGTGCTC
JMFF044A20- GAGAGGTGATTGTAACTTCATCTGTTTTAGCATGTGAATTAGTCAAGGTTAGTTGTGCTC
JMFF003K02- GAGAGGTGATTGTAACTTCATCTGTTTTAGCATGTGAATTAGTCAAGGTTAGTTGTGCTC
JMFF037E09- GAGAGGTGATTGTAACTTCATCTGTTTTAGCATGTGAATTAGTCAAGGTTAGTTGTGCTC
                      ____________________________________________________________
consensus GAGAGGTGATTGTAACTTCATCTGTTTTAGCATGTGAATTAGTCAAGGTTAGTTGTGCTC
 
. : . : . : . : . : . :
JMFF007P21- TTATTCTAATAGCAAAAGAAGGTAATCTGAAGAAACTATTCAAGAATTGGACTTTGGTTG
JMFF044A20- TTATTCTAATAGCAAAAGAAGGTAATCTGAAGAAACTATTCAAGAATTGGACTTTGGTTG
JMFF003K02- TTATTCTAATAGCAAAAGAAGGTAATCTGAAGAAACTATTCAAGAATTGGACTTTGGTTG
JMFF037E09- TTATTCTAATAGCAAAAGAAGGTAATCTGAAGAAACTATTCAAGAATTGGACTTTGGTTG
                      ____________________________________________________________
consensus TTATTCTAATAGCAAAAGAAGGTAATCTGAAGAAACTATTCAAGAATTGGACTTTGGTTG
 
. : . : . : . : . : . :
JMFF007P21- GCTCGTTGACTGCCTCAGGGCTACCTGCTGCTATATATGCACTCCAGAATAGCTTGTTGC
JMFF044A20- GCTCGTTGACTGCCTCAGGGCTACCTGCTGCTATATATGCACTCCAGAATAGCTTGTTGC
JMFF003K02- GCTCGTTGACTGCCTCAGGGCTACCTGCTGCTATATATGCACTCCAGAATAGCTTGTTGC
JMFF037E09- GCTCGTTGACTGCCTCAGGGCTACCTGCTGCTATATATGCACTCCAGAATAGCTTGTTGC
                      ____________________________________________________________
consensus GCTCGTTGACTGCCTCAGGGCTACCTGCTGCTATATATGCACTCCAGAATAGCTTGTTGC
 
. : . : . : . : . : . :
JMFF007P21- AGATTTCATACAAGAATCTTGATTCTCTCACTTTTTCAATTTTGAA-CCAAACAAAGCTG
JMFF044A20- AGATTTCATACAAGAATCTTGATTCTCTCACTTTTTCAATTTTGAA-CCANACAAAGCTG
JMFF003K02- AGATTTCATACAAGAATCTTGATTCTCTCACTTTTTCAATTTTGAA-CCAAACAAAGCTG
JMFF037E09- AGATTTCATACAAGAATCTTGATTCTCTCACTTTTTCAATTTTGAACCCAAACAAAGCTG
rJMFF037E09+ CCAAACAAAGCTG
rJMFF004A10+ CCAAACAAAGCTG
rJMFF003K02+ AAAGCTG
                      ____________________________________________________________
consensus AGATTTCATACAAGAATCTTGATTCTCTCACTTTTTCAATTTTGAA-CCAAACAAAGCTG
 
. : . : . : . : . : . :
JMFF007P21- TTTTTCACTGCTTTGTTTACCTTTATAA
JMFF044A20- TTTTTCACTGCTTTGTTTACCTTTATAA
JMFF003K02- TTTTTCACTGCTTTGTTTACCTTTATAATATTGAGGC
JMFF037E09- TTTTTCACTGCTTTGTTTACCTTTATAATATTGAGGCAGAAGCAAACAATT
rJMFF037E09+ TTTTTCACTGCTTTGTTTACCTTTATAATATTGAGGCAGAAGCAAACAATTCAACAAATT
rJMFF007P10+ TTTTTCACTGCTTNGTTTACCTTTATAATATTGAGGCAGAAGCAAACAATTCAACAAATT
rJMFF004A10+ TTTTTCACTGCTTNGTTTACCTTTATAATATTGAGGCAGAAGCAAACAATTCAACAAATT
rJMFF007P21+ ACTGCTTTGTTTACCTTTATAATATTGAGGCAGAAGCAANCAATTCAACAANTT
rJMFF003K02+ TTTTTCACTGCTTTGTTTACCTTTATAATATTGAGGCAGAAGCAAACAATTCAACAAATT
                      ____________________________________________________________
consensus TTTTTCACTGCTTTGTTTACCTTTATAATATTGAGGCAGAAGCAAACAATTCAACAAATT
 
. : . : . : . : . : . :
rJMFF037E09+ GGGGCTCTTTTCTTGTTGATTATTGCGGCTGTCCTTCTTAGTATTGGTGAAGGCTCCAGC
rJMFF007P10+ GGGGCTCTTTTCTTGTTGATTATTGCGGCTGTCCTTCTTAGTATTGGTGAAGGCTCCAGC
rJMFF004A10+ GGGGCTCTTTTCTTGTTGATTATTGCGGCTGTCCTTCTTAGTATTGGTGAAGGCTCCAGC
rJMFF007P21+ GGGGCTCTTTTCTTGTTGATTATTGCGGCTGTCCTTCTTAGTATTGGTGAAGGCTCCAGC
rJMFF003K02+ GGGGCTCTTTTCTTGTTGATTATTGCGGCTGTCCTTCTTAGTATTGGTGAAGGCTCCAGC
                      ____________________________________________________________
consensus GGGGCTCTTTTCTTGTTGATTATTGCGGCTGTCCTTCTTAGTATTGGTGAAGGCTCCAGC
 
. : . : . : . : . : . :
rJMFF037E09+ AAAGCATCTGCTAGTAATAATAATAATCCTGATGAAATCTTATTCTATGGGATTGCTCCA
rJMFF007P10+ AAAGCATCTGCTAGTAATAATAATAATCCTGATGAAATCTTATTCTATGGGATTGCTCCA
rJMFF004A10+ AAAGCATCTGCTAGTAATAATAATAATCCTGATGAAATCTTATTCTATGGGATTGCTCCA
rJMFF007P21+ AAAGCATCTGCTAGTAATAATAATAATCCTGATGAAATCTTATTCTATGGGATTGCTCCA
rJMFF003K02+ AAAGCATCTGCTAGTAATAATAATAATCCTGATGAAATCTTATTCTATGGGATTGCTCCA
rJMFF044A20+ GGGATTGCTCCA
                      ____________________________________________________________
consensus AAAGCATCTGCTAGTAATAATAATAATCCTGATGAAATCTTATTCTATGGGATTGCTCCA
 
. : . : . : . : . : . :
rJMFF037E09+ GTCTTGGTAGCTTCTGTACTCTCTGGCTTGGCTTCTGCATTGTGTCAGTGGGCCTCTCAG
rJMFF007P10+ GTCTTGGTAGCTTCTGTACTCTCTGGCTTGGCTTCTGCATTGTGTCAGTGGGCCTCTCAG
rJMFF004A10+ GTCTTGGTAGCTTCTGTACTCTCTGGCTTGGCTTCTGCATTGTGTCAGTGGGCCTCTCAG
rJMFF007P21+ GTCTTGGTAGCTTCTGTACTCTCTGGCTTGGCTTCTGCATTGTGTCAGTGGGCCTCTCAG
rJMFF003K02+ GTCTTGGTAGCTTCTGTACTCTCTGGCTTGGCTTCTGCATTGTGTCAGTGGGCCTCTCAG
rJMFF044A20+ GTCTTGGTAGCTTCTGTACTCTCTGGCTTGGCTTCTGCATTGTGTCAGTGGGCCTCTCAG
                      ____________________________________________________________
consensus GTCTTGGTAGCTTCTGTACTCTCTGGCTTGGCTTCTGCATTGTGTCAGTGGGCCTCTCAG
 
. : . : . : . : . : . :
rJMFF037E09+ GTCAAGAAACACAGTTCTTACATGATGACCATTGAAATGTCCATAATTGGGAGTCTCTGC
rJMFF007P10+ GTCAAGAAACACAGTTCTTACATGATGACCATTGAAATGTCCATAATTGGGAGTCTCTGC
rJMFF004A10+ GTCAAGAAACACAGTTCTTACATGATGACCATTGAAATGTCCATAATTGGGAGTCTCTGC
rJMFF007P21+ GTCAAGAAACACAGTTCTTACATGATGACCATTGAAATGTCCATAATTGGGAGTCTCTGC
rJMFF003K02+ GTCAAGAAACACAGTTCTTACATGATGACCATTGAAATGTCCATAATTGGGAGTCTCTGC
rJMFF044A20+ GTCAAGAAACACAGTTCTTACATGATGACCATTGAAATGTCCATAATTGGGAGTCTCTGC
                      ____________________________________________________________
consensus GTCAAGAAACACAGTTCTTACATGATGACCATTGAAATGTCCATAATTGGGAGTCTCTGC
 
. : . : . : . : . : . :
rJMFF037E09+ TTGATAGCTAGTGCTTTCAAGTCTCCAGATGGAGAAGCCATCAGACTGCATGGATTGTTC
rJMFF007P10+ TTGATAGCTAGTGCTTTCAAGTCTCCAGATGGAGAAGCCATCAGACTGCATGGATTGTTC
rJMFF004A10+ TTGATAGCTAGTGCTTTCAAGTCTCCAGATGGAGAAGCCATCAGACTGCATGGATTGTTC
rJMFF007P21+ TTGATAGCTAGTGCTTTCAAGTCTCCAGATGGAGAAGCCATCAGACTGCATGGATTGTTC
rJMFF003K02+ TTGATAGCTAGTGCTTTCAAGTCTCCAGATGGAGAAGCCATCAGACTGCATGGATTGTTC
rJMFF044A20+ TTGATAGCTAGTGCTTTCAAGTCTCCAGATGGAGAAGCCATCAGACTGCATGGATTGTTC
                      ____________________________________________________________
consensus TTGATAGCTAGTGCTTTCAAGTCTCCAGATGGAGAAGCCATCAGACTGCATGGATTGTTC
 
. : . : . : . : . : . :
rJMFF037E09+ TATGGTTGGACTGCACTGACAATGATCCCTGTTACACTAAATGCCGTTGGTGGAATTCTT
rJMFF007P10+ TATGGTTGGACTGCACTGACAATGATCCCTGTTACACTAAATGCCGTTGGTGGAATTCTT
rJMFF004A10+ TATGGTTGGACTGCACTGACAATGATCCCTGTTACACTAAATGCCGTTGGTGGAATTCTT
rJMFF007P21+ TATGGTTGGACTGCACTGACAATGATCCCTGTTACACTAAATGCCGTTGGTGGAATTCTT
rJMFF003K02+ TATGGTTGGACTGCACTGACAATGATCCCTGTTACACTAAATGCCGTTGGTGGAATTCTT
rJMFF044A20+ TATGGTTGGACTGCACTGACAATGATCCCTGTTACACTAAATGCCGTTGGTGGAATTCTT
                      ____________________________________________________________
consensus TATGGTTGGACTGCACTGACAATGATCCCTGTTACACTAAATGCCGTTGGTGGAATTCTT
 
. : . : . : . : . : . :
rJMFF037E09+ GTTGGTCTTGTGACCTCCTATGCTGGTGGTGTACGAAAGGGATTTGTCATTGTCTCTGCG
rJMFF007P10+ GTTGGTCTTGTGACCTCCTATGCTGGTGGTGTACGAAAGGGATTTGTCATTGTCTCTGCG
rJMFF004A10+ GTTGGTCTTGTGACCTCCTATGCTGGTGGTGTACGAAAGGGATTTGTCATTGTCTCTGCG
rJMFF007P21+ GTTGGTCTTGTGACCTCCTATGCTGGTGGTGTACGAAAGGGATTTGTCATTGTCTCTGCG
rJMFF003K02+ GTTGGTCTTGTGACCTCCTATGCTGGTGGTGTACGAAAGGGATTTGTCATTGTCTCTGCG
rJMFF044A20+ GTTGGTCTTGTGACCTCCTATGCTGGTGGTGTACGAAAGGGATTTGTCATTGTCTCTGCG
                      ____________________________________________________________
consensus GTTGGTCTTGTGACCTCCTATGCTGGTGGTGTACGAAAGGGATTTGTCATTGTCTCTGCG
 
. : . : . : . : . : . :
rJMFF037E09+ CTCCTTGTTACCGCTCTTCTGCAGTTCATCTTTGATGGCAAACCTCCTTCGATATACTGC
rJMFF007P10+ CTCCTTGTTACCGCTCTTCTGCAGTTCATCTTTGATGGCAAACCTCCTTCGATATACTGC
rJMFF004A10+ CTCCTTGTTACCGCTCTTCTGCAGTTCATCTTTGATGGCAAACCTCCTTCGATATACTGC
rJMFF007P21+ CTCCTTGTTACCGCTCTTCTGCAGTTCATCTTTGATGGCAAACCTCCTTCGATATACTGC
rJMFF003K02+ CTCCTTGTTACCGCTCTTCTGCAGTTCATCTTTGATGGCAAACCTCCTTCGATATACTGC
rJMFF044A20+ CTCCTTGTTACCGCTCTTCTGCAGTTCATCTTTGATGGCAAACCTCCTTCGATATACTGC
                      ____________________________________________________________
consensus CTCCTTGTTACCGCTCTTCTGCAGTTCATCTTTGATGGCAAACCTCCTTCGATATACTGC
 
. : . : . : . : . : . :
rJMFF037E09+ CTCATGGCACTTCCACTGGTCATTACTAGCATCTCTATTTACCAAAAATACCCATACCGT
rJMFF007P10+ CTCATGGCACTTCCACTGGTCATTACTAGCATCTCTATTTACCAAAAATACCCATACCGT
rJMFF004A10+ CTCATGGCACTTCCACTGGTCATTACTAGCATCTCTATTTACCAAAAATACCCATACCGT
rJMFF007P21+ CTCATGGCACTTCCACTGGTCATTACTAGCATCTCTATTTACCAAAAATACCCATACCGT
rJMFF003K02+ CTCATGGCACTTCCACTGGTCATTACTAGCATCTCTATTTACCAAAAATACCCATACCGT
rJMFF044A20+ CTCATGGCACTTCCACTGGTCATTACTAGCATCTCTATTTACCAAAAATACCCATACCGT
                      ____________________________________________________________
consensus CTCATGGCACTTCCACTGGTCATTACTAGCATCTCTATTTACCAAAAATACCCATACCGT
 
. : . : . : . : . : . :
rJMFF037E09+ ATTAAGAAGAAGGAATCATGAAGATGCAGCATTTTGAGTGGAAGTTTACTTGGCCATACA
rJMFF007P10+ ATTAAGAAGAAGGAATCATGAAGATGCAGCATTTTGAGTGGAAGTTTACTTGGCCATACA
rJMFF004A10+ ATTAAGAAGAAGGAATCATGAAGATGCAGCATTTTGAGTGGAAGTTTACTTGGCCATACA
rJMFF007P21+ ATTAAGAAGAAGGAATCATGAAGATGCAGCATTTTGAGTGGAAGTTTACTTGGCCATACA
rJMFF003K02+ ATTAAGAAGAAGGAATCATGAAGATGCAGCATTTTGAGTGGAAGTTTACTTGGCCATACA
rJMFF044A20+ ATTAAGAAGAAGGAATCATGAAGATGCAGCATTTTGAGTGGAAGTTTACTTGGCCATACA
                      ____________________________________________________________
consensus ATTAAGAAGAAGGAATCATGAAGATGCAGCATTTTGAGTGGAAGTTTACTTGGCCATACA
 
. : . : . : . : . : . :
rJMFF037E09+ CCAAAACTAGTTTTGAATTTACTGACAGATATAGGGAAGAGTTGCTGTAATGCTGTATTA
rJMFF007P10+ CCAAAACTAGTTTTGAATTTACTGACAGATATAGGGAAGAGTTGCTGTAATGCTGTATTA
rJMFF004A10+ CCAAAACTAGTTTTGAATTTACTGACAGATATAGGGAAGAGTTGCTGTAATGCTGTATTA
rJMFF007P21+ CCAAAACTAGTTTTGAATTTACTGACAGATATAGGGAAGAGTTGCTGTAATGCTGTATTA
rJMFF003K02+ CCAAAACTAGTTTTGAATTTACTGACAGATATAGGGAAGAGTTGCTGTAATGCTGTATTA
rJMFF044A20+ CCAAAACTAGTTTTGAATTTACTGACAGATATAGGGAAGAGTTGCTGTAATGCTGTATTA
                      ____________________________________________________________
consensus CCAAAACTAGTTTTGAATTTACTGACAGATATAGGGAAGAGTTGCTGTAATGCTGTATTA
 
. : . : . : . : . : . :
rJMFF037E09+ TTGTTATTGTTTACAGAAGTTGACTGCCTCAGGTTAATAT-GTGAGAAAGGAT
rJMFF007P10+ TTGTTATTGTTTACAGAAGTTGACTGCCTCAGGTTAATAT-GTGAGAAAGGAT
rJMFF004A10+ TTGTTATTGTTTACAGAAGTTGACTGCCTCAGGTTAATAT-GTGAGAAAGGAT
rJMFF007P21+ TTGTTATTGTTTACAGAAGTTGACTGCCTCAGGTTAATA--GTGAGAAAGGAT
rJMFF003K02+ TTGTTATTGTTTACAGAAGTTGACTGCCTCAGGTTAATA--GTGAGAAAGGAT
rJMFF044A20+ TTGTTATTGTTTACAGAAGTTGACTGCCTCAGGTTAATATGTTGAGAAAGGATTGGCATT
                      ____________________________________________________________
consensus TTGTTATTGTTTACAGAAGTTGACTGCCTCAGGTTAATAT-GTGAGAAAGGATTGGCATT