Previous Contig 010382:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF044A08Sequence634010382 (2)gb:BT009706_16401671e-30Arabidopsis thaliana At5g62950 gene, complete cds.615010382 (2)gb:BT009706_16401672e-17Arabidopsis thaliana At5g62950 gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF044A08- AATTTCTAATTCCTCAAAGCCGAAGACACAGTGAGGTCTGACG
                      ____________________________________________________________
consensus AATTTCTAATTCCTCAAAGCCGAAGACACAGTGAGGTCTGACG
 
. : . : . : . : . : . :
JMFF044A08- GGTTTCGACTTTCGACCACCTGCGACTCCCGCAGCACTGACGGCGGCATCAGGGGTTCAA
                      ____________________________________________________________
consensus GGTTTCGACTTTCGACCACCTGCGACTCCCGCAGCACTGACGGCGGCATCAGGGGTTCAA
 
. : . : . : . : . : . :
JMFF044A08- TAGTTCCCTTGTATTGATTGGGTTACAAAAATCTAAAGTTCTAGTTCTGGTTTTCTTTGA
                      ____________________________________________________________
consensus TAGTTCCCTTGTATTGATTGGGTTACAAAAATCTAAAGTTCTAGTTCTGGTTTTCTTTGA
 
. : . : . : . : . : . :
JMFF044A08- TCACTGGTGTAGCCGGTCATGTTGATTTGAAGATTAAAGTTATAACAGCTCCGTGTGCTC
                      ____________________________________________________________
consensus TCACTGGTGTAGCCGGTCATGTTGATTTGAAGATTAAAGTTATAACAGCTCCGTGTGCTC
 
. : . : . : . : . : . :
JMFF044A08- ACCGTTGTGCTTCTGAGGATGAAGATTCTTGAAGCAAATGCCGGTGCACTTACTAACTTT
                      ____________________________________________________________
consensus ACCGTTGTGCTTCTGAGGATGAAGATTCTTGAAGCAAATGCCGGTGCACTTACTAACTTT
 
. : . : . : . : . : . :
JMFF044A08- GAGGTGCTTGACTTTCTACGATCAAGAGGTGCAGGAAATGATGCTACAAGGGTCATGGTT
rJMFF044A08+ ACAAGGGTCATGGTT
                      ____________________________________________________________
consensus GAGGTGCTTGACTTTCTACGATCAAGAGGTGCAGGAAATGATGCTACAAGGGTCATGGTT
 
. : . : . : . : . : . :
JMFF044A08- CCTGTTTTACCATCTGAGTTCAAGGTTTATGATTACTTAGAGCGAACTGCTGCTTGCAAT
rJMFF044A08+ CCTGTTTTACCATCTGAGTTCAAGGTTTATGATTACTTAGAGCGAACTGCTGCTTGCAAT
                      ____________________________________________________________
consensus CCTGTTTTACCATCTGAGTTCAAGGTTTATGATTACTTAGAGCGAACTGCTGCTTGCAAT
 
. : . : . : . : . : . :
JMFF044A08- CAGACAAGAAAGATTATAGAAGAATTTTTAGCTAAATGTAAACAATTCAATCTTGCAAAA
rJMFF044A08+ CAGACAAGAAAGATTATAGAAGAATTTTTAGCTAAATGTAAACAATTCAATCTTGCAAAA
                      ____________________________________________________________
consensus CAGACAAGAAAGATTATAGAAGAATTTTTAGCTAAATGTAAACAATTCAATCTTGCAAAA
 
. : . : . : . : . : . :
JMFF044A08- GCTGAGATATTGAACATAACCAACATTAGGCCATCCTCTTTGGTTGAAATTGACACGATT
rJMFF044A08+ GCTGAGATATTGAACATAACCAACATTAGGCCATCCTCTTTGGTTGAAATTGACACGATT
                      ____________________________________________________________
consensus GCTGAGATATTGAACATAACCAACATTAGGCCATCCTCTTTGGTTGAAATTGACACGATT
 
. : . : . : . : . : . :
JMFF044A08- ATTGAGGAATGTGATACGCGCTTTGGGGAAAATGAAGAAACTATTAACGAGCTGATTGAA
rJMFF044A08+ ATTGAGGAATGTGATACGCGCTTTGGGGAAAATGAAGAAACTATTAACGAGCTGATTGAA
                      ____________________________________________________________
consensus ATTGAGGAATGTGATACGCGCTTTGGGGAAAATGAAGAAACTATTAACGAGCTGATTGAA
 
. : . : . : . : . : . :
JMFF044A08- ACAATCACCCAGGTCTTGCCTCCTCCTCCAACTG-AATGAATACGGATACAG
rJMFF044A08+ ACAATCACCCAGGTCTTGCCTCCTCCTCCAACTGAAATGAATACGGATACAGAAGCTGCT
                      ____________________________________________________________
consensus ACAATCACCCAGGTCTTGCCTCCTCCTCCAACTGAAATGAATACGGATACAGAAGCTGCT
 
. : . : . : . : . : . :
rJMFF044A08+ AAGGATGCTGGAACTGATTCTCCAACGCAAATGGAGACTGATGCGCAAGCTGTTCAAGAG
                      ____________________________________________________________
consensus AAGGATGCTGGAACTGATTCTCCAACGCAAATGGAGACTGATGCGCAAGCTGTTCAAGAG
 
. : . : . : . : . : . :
rJMFF044A08+ CAAGCAGCTCCAGATGGAGGCGACTAAATAGAAAAGCTGCTTACTTGGAATGAAGAGTTT
                      ____________________________________________________________
consensus CAAGCAGCTCCAGATGGAGGCGACTAAATAGAAAAGCTGCTTACTTGGAATGAAGAGTTT
 
. : . : . : . : . : . :
rJMFF044A08+ TAGTTAGAATTACGTTTGATTAGTGGATGCAAACATCATGTGAAAATGGATGTTTTTCTC
                      ____________________________________________________________
consensus TAGTTAGAATTACGTTTGATTAGTGGATGCAAACATCATGTGAAAATGGATGTTTTTCTC
 
. : . : . : . : . : . :
rJMFF044A08+ CTCCACTACTAGTTACAACCTTATATTTTCAGTTCAACATTTCGCCAATCAAGATTGCTT
                      ____________________________________________________________
consensus CTCCACTACTAGTTACAACCTTATATTTTCAGTTCAACATTTCGCCAATCAAGATTGCTT
 
. : . : . : . : . : . :
rJMFF044A08+ TGGTTCTGTTAGATTAAGTTATGTTGCAATCCATGTAGAAGTTGTGTTAAAAAAAAAAAT
                      ____________________________________________________________
consensus TGGTTCTGTTAGATTAAGTTATGTTGCAATCCATGTAGAAGTTGTGTTAAAAAAAAAAAT