Previous Contig 010379:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF016D23Sequence489005209 (3)679010379 (2)gb:AB018119_15138956e-05Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSN2.>gb:AY099859_15768
JMFF043P12Sequence633005209 (3)gb:AP003246_18261868e-20Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P042610010379 (2)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF016D23+ GGCAAGTGCAGAGCCAATGTTTCT
                      ____________________________________________________________
consensus GGCAAGTGCAGAGCCAATGTTTCT
 
. : . : . : . : . : . :
rJMFF016D23+ GTCTTTATCGTGTCCGATTTATCTCTCCGGCAACGCGGCTTCATCTGTNTTTCCATGGGC
rJMFF043P12+ TTCCATGGGC
                      ____________________________________________________________
consensus GTCTTTATCGTGTCCGATTTATCTCTCCGGCAACGCGGCTTCATCTGTNTTTCCATGGGC
 
. : . : . : . : . : . :
rJMFF016D23+ GGCGGCATCCCAAGATCTCCACCGGCAGTACGCAGCACCTAGCCGTCCCCCG-CGGCGCT
rJMFF043P12+ GGCGGCATCCCAAGATCTCCACCGGCAGTACGCAGCACCTAGCCGTCCCCCGCCGGCGCT
                      ____________________________________________________________
consensus GGCGGCATCCCAAGATCTCCACCGGCAGTACGCAGCACCTAGCCGTCCCCCGCCGGCGCT
 
. : . : . : . : . : . :
rJMFF016D23+ CTCAGGGACGGCGTTGCTGCAAAAGGCGGCCGAAATCGGTGCAACGTCGTCTCACGGCTC
rJMFF043P12+ CTCAGCGACGGCGTTGCTGCAAAAGGCGGCCGAAATCGGTGCAACGTCGTCTCACGGCTC
                      ____________________________________________________________
consensus CTCAGGGACGGCGTTGCTGCAAAAGGCGGCCGAAATCGGTGCAACGTCGTCTCACGGCTC
 
. : . : . : . : . : . :
rJMFF016D23+ GTTTCTCTGCGGCCTTGGATTAGCGACGTCGAGCGGTTCTAACCCGCAAGATGGCTTAAC
rJMFF043P12+ GTTTCTCTGCGGCCTTGGATTAGCGACGTCGAGCGGTTCTAACCCGCAAGATGGCTTAAC
                      ____________________________________________________________
consensus GTTTCTCTGCGGCCTTGGATTAGCGACGTCGAGCGGTTCTAACCCGCAAGATGGCTTAAC
 
. : . : . : . : . : . :
rJMFF016D23+ GAAATGGAACGAACATGTAAAGCAGGAGAATAAGTCAATCTCGTCGCCGTCGTCTCCGAC
rJMFF043P12+ GAAATGGAACGAACATGTAAAGCAGGAGAATAAGTCAATCTCGTCGCCGTCGTCTCCGAC
                      ____________________________________________________________
consensus GAAATGGAACGAACATGTAAAGCAGGAGAATAAGTCAATCTCGTCGCCGTCGTCTCCGAC
 
. : . : . : . : . : . :
rJMFF016D23+ GACAATGATCTTCACCAACAACCCTCCGACGCTCGATTTTCTCGGTGTGGGAGCGGGTGC
rJMFF043P12+ GACAATGATCTTCACCAACAACCCTCCGACGCTCGATTTTCTCGGTGTGGGAGCGGGTGC
                      ____________________________________________________________
consensus GACAATGATCTTCACCAACAACCCTCCGACGCTCGATTTTCTCGGTGTGGGAGCGGGTGC
 
. : . : . : . : . : . :
rJMFF016D23+ CACTCCGGCTTCTTTTCTGGGCTCAATGAATAATAGCGGCGGCGGCGGCGGCGTGGCTTC
rJMFF043P12+ CACTCCGGCTTCTTTTCTGGGCTCAATGAATAATAGCGGCGGCGGCGGCGGCGTGGCTTC
                      ____________________________________________________________
consensus CACTCCGGCTTCTTTTCTGGGCTCAATGAATAATAGCGGCGGCGGCGGCGGCGTGGCTTC
 
. : . : . : . : . : . :
rJMFF016D23+ TACCGGAGACTGTTGGGATGACACCTCCGATCGGAAATTCGGTTTCCATTAGCAAAAATA
rJMFF043P12+ TACCGGAGACTGTTGGGATGACACCTCCGATCGGAAATTCGGTTTCCATTAGCAAAAATA
                      ____________________________________________________________
consensus TACCGGAGACTGTTGGGATGACACCTCCGATCGGAAATTCGGTTTCCATTAGCAAAAATA
 
. : . : . : . : . : . :
rJMFF016D23+ TAATAATGAATGCTTTTTTGTCCATTCAATTCAATTCGTAGTTTTAATCCTTTGGCGTTT
rJMFF043P12+ TAATAATGAATGCTTTTTTGTCCATTCAATTCAATTCGTAGTTTTAATCCTTTGGCGTTT
                      ____________________________________________________________
consensus TAATAATGAATGCTTTTTTGTCCATTCAATTCAATTCGTAGTTTTAATCCTTTGGCGTTT
 
. : . : . : . : . : . :
rJMFF016D23+ CAATCCCCACCAGGATCCCAGAAAAAACCTTAATTATAAATCGTAGTCGCAGGTTGATGG
rJMFF043P12+ CAATCCCCACCAGGATCCCAGAAAAAACCTTAATTATAAATCGTAGTCGCAGGTTGATGG
                      ____________________________________________________________
consensus CAATCCCCACCAGGATCCCAGAAAAAACCTTAATTATAAATCGTAGTCGCAGGTTGATGG
 
. : . : . : . : . : . :
rJMFF016D23+ AACTTAGTTTTGTCTGTATATATTGTCATTTGATTATGTAGCTAGCAGGTTAGTGA
rJMFF043P12+ AACTTAGTTTTGTCTGTATATATTGTCATTTGATTATGTAGCTAGCAGGTTAGTGATGAT
                      ____________________________________________________________
consensus AACTTAGTTTTGTCTGTATATATTGTCATTTGATTATGTAGCTAGCAGGTTAGTGATGAT