Previous Contig 010378:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF011D06Sequence552001193 (11)gb:AY286010_15947822e-47Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.721010378 (12)gb:AY044235_15610186e-35Lycopersicon esculentum transcription factor JERF1 (JERF1) mRNA, complete cds.
JMFF012I03Sequence539001193 (11)gb:AY286010_15947822e-38Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.714010378 (12)gb:AY044235_15610182e-33Lycopersicon esculentum transcription factor JERF1 (JERF1) mRNA, complete cds.
JMFF019B13Sequence403001193 (11)gb:AY286010_15947827e-21Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.259010378 (12)
JMFF024F09Sequence470001193 (11)gb:AY286010_15947829e-30Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.717010378 (12)gb:AY286010_15947821e-40Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF025A04Sequence537001193 (11)gb:AY286010_15947824e-30Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.753010378 (12)gb:AY044235_15610187e-35Lycopersicon esculentum transcription factor JERF1 (JERF1) mRNA, complete cds.
JMFF026F08Sequence567001193 (11)gb:AY286010_15947823e-47Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.757010378 (12)gb:AY286010_15947823e-44Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF037F17Sequence548001193 (11)gb:AY286010_15947823e-45Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.666010378 (12)gb:AY286010_15947823e-27Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF039M08Sequence541001193 (11)gb:AY286010_15947823e-45Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.726010378 (12)gb:AY044235_15610187e-31Lycopersicon esculentum transcription factor JERF1 (JERF1) mRNA, complete cds.
JMFF039N08Sequence547001193 (11)gb:AY286010_15947823e-46Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.724010378 (12)gb:AY044235_15610186e-36Lycopersicon esculentum transcription factor JERF1 (JERF1) mRNA, complete cds.
JMFF043P11Sequence631000295 (7)pir|T48328|T483282e-38importin alpha-like protein - Arabidopsis thaliana>gb:ATF15A17_1548643 Arabidops651010378 (12)gb:AY286010_15947827e-16Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFF044E01Sequence612001193 (11)gb:AY286010_15947824e-55Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.501010378 (12)gb:AY286010_15947822e-17Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.
JMFN008M24Sequence642010378 (12)gb:AY286010_15947824e-28Nicotiana tabacum callus-expressing factor (CEF1) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF026F08+ ACTTCGGCTACTATGATCC
                      ____________________________________________________________
consensus ACTTCGGCTACTATGATCC
 
. : . : . : . : . : . :
rJMFF026F08+ TTCGAACTTTTTTGAGGAGAAGCCTTTGACAAAACCGAATGGCTATATAGATATGTGCCC
rJMFF024F09+ GACAAAACCGAATGGCTATATAGATATGTGCCC
rJMFF025A04+ GACAAAACCGAATGGCTATATAGATATGTGCCC
                      ____________________________________________________________
consensus TTCGAACTTTTTTGAGGAGAAGCCTTTGACAAAACCGAATGGCTATATAGATATGTGCCC
 
. : . : . : . : . : . :
rJMFF026F08+ TGTGCCCGGAGATATGGGTTCCAAATCGTATTTGCCCTCTGATGCTGCTAACCTTTACTT
rJMFF024F09+ TGTGCCCGGAGATATGGGTTCCAAATCGTATTTGCCCTCTGATGCTGCTAACCTTTACTT
rJMFF025A04+ TGTGCCCGGAGATATGGGTTCCAAATCGTATTTGCCCTNTGATGCTGCTAACCTTTACTT
rJMFF039N08+ TTTACTT
rJMFF039M08+ CTTTACTT
rJMFF011D06+ ACTT
                      ____________________________________________________________
consensus TGTGCCCGGAGATATGGGTTCCAAATCGTATTTGCCCTCTGATGCTGCTAACCTTTACTT
 
. : . : . : . : . : . :
rJMFF026F08+ CAGCTCCGAGGAAGGAAGCAATTTGCTCGACTATTCTGATTTCGGGTGGGCGGACCGAAG
rJMFF024F09+ CAGCTCCGAGGAAGGAAGCAATTTGCTCGACTATTCTGATTTCGGGTGGGCGGACCGAAG
rJMFF025A04+ CAGCTCCGAGGAAGGAAGCAATTTGCTCGACTATTCTGATTTCGGGTGGGCGGACCGAAG
rJMFF039N08+ CAGCTCCGAGGAAGGAAGCAATTTGCTCGACTATTCTGATTTCGGGTGGGCGGACCGAAG
rJMFF039M08+ CAGCTCCGAGGAAGGAAGCAATTTGCTCGACTATTNTGATTTCGGGTGGGCGGACCGAAG
rJMFF012I03+ CTCCGAGGAAGGAAGCAATTTGCTCGACTATTNTGATTTCGGGTGGGCGGACCGAAG
rJMFF011D06+ CAGCTCCGAGGAAGGAAGCAATTTGCTCGACTATTNTGATTTCGGGTGGGCGGACCGAAG
rJMFF037F17+ AG
                      ____________________________________________________________
consensus CAGCTCCGAGGAAGGAAGCAATTTGCTCGACTATTCTGATTTCGGGTGGGCGGACCGAAG
 
. : . : . : . : . : . :
rJMFF026F08+ TT-CCCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
rJMFF024F09+ TT-CCCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
rJMFF025A04+ TTCCCCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
rJMFF039N08+ TT-CCCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
rJMFF039M08+ TTCCCCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
rJMFF012I03+ TT-CCCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
JMFN008M24- CCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
rJMFF011D06+ TT-CCCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
rJMFF037F17+ TT-CCCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
                      ____________________________________________________________
consensus TT-CCCGGAGTCCTGAAATATCATCTGTTCTGTCAGCTGCCCTAGAAGCCGATGAAGCTC
 
. : . : . : . : . : . :
rJMFF026F08+ AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
rJMFF024F09+ AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
rJMFF025A04+ AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
rJMFF039N08+ AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
rJMFF039M08+ AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
rJMFF012I03+ AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
rJMFF044E01+ ACCTGCTGG
JMFN008M24- AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
rJMFF011D06+ AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
rJMFF037F17+ AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
rJMFF043P11+ AGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
                      ____________________________________________________________
consensus AGTTTGCGGAGGAAGCCAACCCTCAAAAGAAACTGAAGTCGAGTTCCGACAACCTGCTGG
 
. : . : . : . : . : . :
rJMFF026F08+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
rJMFF024F09+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
rJMFF025A04+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
rJMFF039N08+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
rJMFF039M08+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
rJMFF012I03+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
rJMFF044E01+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
JMFN008M24- CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
rJMFF011D06+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
rJMFF037F17+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
rJMFF043P11+ CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTNTGAGGCACAGA
                      ____________________________________________________________
consensus CAAGCAATGGAAACACTGTCGAGAAGCTGTCTGAAGAGCTCTCGGCTTTTGAGGCACAGA
 
. : . : . : . : . : . :
rJMFF026F08+ TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
rJMFF024F09+ TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
rJMFF025A04+ TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
rJMFF039N08+ TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
rJMFF039M08+ TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
rJMFF012I03+ TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
rJMFF044E01+ TGAAGTTTTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
JMFN008M24- TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
rJMFF011D06+ TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
rJMFF037F17+ TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
rJMFF043P11+ TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
                      ____________________________________________________________
consensus TGAAGTTCTTCGATATCCCTTATCTCGAAGGGAACTGCGGTGCACCAACCTTCAACGCCT
 
. : . : . : . : . : . :
rJMFF026F08+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCCACGACATCCCTTCTT
rJMFF024F09+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
rJMFF025A04+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
rJMFF039N08+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
rJMFF039M08+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
rJMFF012I03+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
rJMFF044E01+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
rJMFF019B13+ GTGGTGCTTCGTCGACATCCGTTNTT
JMFN008M24- ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
rJMFF011D06+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
rJMFF037F17+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
rJMFF043P11+ ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
                      ____________________________________________________________
consensus ATGCGACTCAGGACGGTGGAAACGCCATGAACCTGTGGTGCTTCGACGACATCCCTTCTT
 
. : . : . : . : . : . :
rJMFF026F08+ TTACAGGGGACGTCTTCTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF024F09+ TTACAGGGGACGTCTTCTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF025A04+ TTACAGGGGACGTCTTNTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF039N08+ TTACAGGGGACGTCTTNTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF039M08+ TTACAGGGGACGTCTTNTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF012I03+ TTACAGGGGACGTCTTNTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF044E01+ TTACAGGGGACGTCTTTTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF019B13+ TTNCAGGGGACGTCTTCTAAGCCAACCCTCCTNNNGTNNCCGTTGTAAATAAAGCTTTTA
JMFN008M24- TTACAGGGGACGTCTTCTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF011D06+ TTACAGGGGACGTCTTCTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF037F17+ TTACAGGGGACGTCTTNTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
rJMFF043P11+ TTACAGGGGACGTCTTCTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
                      ____________________________________________________________
consensus TTACAGGGGACGTCTTCTAAGCCAACCCTCCTCCCGTGCCCGTTGTAAATAAAGCTTTTA
 
. : . : . : . : . : . :
rJMFF026F08+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
rJMFF024F09+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
rJMFF025A04+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATT-CTCATCACTGTAAAAGCTTGGATG
rJMFF039N08+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
rJMFF039M08+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
rJMFF012I03+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
rJMFF044E01+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
rJMFF019B13+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATTNATCATCACTGTAAAAGNTNGGATG
JMFN008M24- TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
rJMFF011D06+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
rJMFF037F17+ TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
rJMFF043P11+ TATGAGTATGGTTTGATGCCGGAACACTNGTAATTGCTCATCACTGTAAAAGCTTGGATG
                      ____________________________________________________________
consensus TATGAGTATGGTTTGATGCCGGAACACTTGTAATTGCTCATCACTGTAAAAGCTTGGATG
 
. : . : . : . : . : . :
rJMFF026F08+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF024F09+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF025A04+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF039N08+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF039M08+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF012I03+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF044E01+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF019B13+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTNGAGTGTGGTTAAGAGCAACATTGNGAATN
JMFN008M24- ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF011D06+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF037F17+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
rJMFF043P11+ ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
                      ____________________________________________________________
consensus ACTGGGGTGGTGCCCGTGTTCTTCCAGGTTCGAGTGTGGTTAAGAGCAACATTGTGAATT
 
. : . : . : . : . : . :
rJMFF026F08+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF024F09+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF025A04+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF039N08+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF039M08+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF012I03+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF044E01+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF019B13+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATAT
JMFN008M24- TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF011D06+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF037F17+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
rJMFF043P11+ TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
                      ____________________________________________________________
consensus TGGGATCAATAGCCTCTGTTGCCGGACTTTAAACTGCTGTCTTTAAATATGATGTGTATG
 
. : . : . : . : . : . :
rJMFF026F08+ GATAATGAATC
rJMFF024F09+ GATAATGAATCTGAAACCCCAA
rJMFF025A04+ GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATATT
rJMFF039N08+ GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATATT
rJMFF039M08+ GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATATT
rJMFF012I03+ GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATATT
rJMFF044E01+ GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATA
JMFN008M24- GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATATT
rJMFF011D06+ GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATATT
rJMFF037F17+ GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATATT
rJMFF043P11+ GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATATT
                      ____________________________________________________________
consensus GATAATGAATCTGAAACCCCAACATTCTTATATGTTGTTTTGTTTGTAATGTTTTATATT
 
. : . : . : . : . : . :
rJMFF025A04+ T
rJMFF039N08+ TTGCTGTTTTTTTTTCCGTGATATAGTGTTGATGAATAATCAAAATTTCAAGTGGGGT
rJMFF039M08+ TTGCTGTTTTTTTTTCCGTGATATAGTGTTGATGAATAATCAAAATTTCAAGTGGGGT
rJMFF012I03+ TTGCTGTTTTTTTTTCCGTGATATAGTGTTGATGAATAATCAAAATTTCAAGTGGGGT
JMFN008M24- TTGCTGTTTTTTTTTCCGTGATATAGTGTTGATGAATAATCAAAAT
rJMFF011D06+ TTGCTGTTTTTTTTTCCGTGATATAGTGTTGATGAATAATCAAAATTTCAAGTGGGGT
rJMFF037F17+ TTGCTGTTTTTTTTTCCGTGATATAGTGTTGATGAATAATCAAAATTTCAAGTGGGGT
rJMFF043P11+ TTGCTGTTTTTTTTTCCGTGATATAGTGTTGATGAATAATCAAAATTTCAAGTGGGGTTG
                      ____________________________________________________________
consensus TTGCTGTTTTTTTTTCCGTGATATAGTGTTGATGAATAATCAAAATTTCAAGTGGGGTTG
 
. : . : . : . : . : . :
rJMFF043P11+ GCACTTGGGAGACTTTTTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus GCACTTGGGAGACTTTTTCAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG