Previous Contig 010369:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF003C09Sequence420001870 (4)gb:AX078761_14607060.008Sequence 2 from Patent WO0105951.>gb:AB025633_1516593 Arabidopsis thaliana genom764010369 (2)gb:AF542974_18102363e-37Triticum aestivum Emr1 mRNA, complete cds.
JMFF043O16Sequence672001870 (4)gb:AX078761_14607068e-05Sequence 2 from Patent WO0105951.>gb:AB025633_1516593 Arabidopsis thaliana genom508010369 (2)gb:AK011768_11565850.007Mus musculus 10 days embryo whole body cDNA, RIKEN full-length enriched library,

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF003C09+ GGCTGAGCGCNTCAGCAAGCATTTTACTGACAATGGAAGAGACAGGGAAGCNTG
                      ____________________________________________________________
consensus GGCTGAGCGCNTCAGCAAGCATTTTACTGACAATGGAAGAGACAGGGAAGCNTG
 
. : . : . : . : . : . :
rJMFF003C09+ GCAACGCAACAATATGATATTTTATCAGGGTGGAAAGCGCCAGCTGTTTGGTTACATGGC
                      ____________________________________________________________
consensus GCAACGCAACAATATGATATTTTATCAGGGTGGAAAGCGCCAGCTGTTTGGTTACATGGC
 
. : . : . : . : . : . :
rJMFF003C09+ CACAAAGAAAGATCTAGACGTATTTAACCAGCATTCACAGGGTAAATCAAAACTGAAGTA
                      ____________________________________________________________
consensus CACAAAGAAAGATCTAGACGTATTTAACCAGCATTCACAGGGTAAATCAAAACTGAAGTA
 
. : . : . : . : . : . :
rJMFF003C09+ TGAGATTAGATCTCATCTAGAGACGGTGGTCAATTCAATGAAGCAGATGAATGAGGATAA
                      ____________________________________________________________
consensus TGAGATTAGATCTCATCTAGAGACGGTGGTCAATTCAATGAAGCAGATGAATGAGGATAA
 
. : . : . : . : . : . :
rJMFF003C09+ TCAACAGCTAATCTGGTACAAGAACAACGCACAAAAGCACCAGAAAATTGCAAAGGCTGT
rJMFF043O16+ AAAAGCACCAGAAAATTGCAAAGGCTGT
                      ____________________________________________________________
consensus TCAACAGCTAATCTGGTACAAGAACAACGCACAAAAGCACCAGAAAATTGCAAAGGCTGT
 
. : . : . : . : . : . :
rJMFF003C09+ TAAGGAATCTTTTATTGTGATGGGTGAGAAGTACCGCCAATCTGCAGAAGAAACAAAAAT
rJMFF043O16+ TAAGGAATCTTTTATTGTGATGGGTGAGAAGTACCGCCAATTTGCAGAAGAAACAAAAAT
                      ____________________________________________________________
consensus TAAGGAATCTTTTATTGTGATGGGTGAGAAGTACCGCCAATTTGCAGAAGAAACAAAAAT
 
. : . : . : . : . : . :
rJMFF003C09+ TGTTCGTTCAAAAACGAAAGATCACCATGTGCAGAAAGAGGAGGAGATTGAGTATTTGGA
rJMFF043O16+ TGTTTGTTCAAAAACGAAAGATCCCCATGTGCAGAAAGAGGAGGAGATTGAGTATTTGGA
                      ____________________________________________________________
consensus TGTTTGTTCAAAAACGAAAGATCCCCATGTGCAGAAAGAGGAGGAGATTGAGTATTTGGA
 
. : . : . : . : . : . :
rJMFF003C09+ ACATTTAGTTCAGCAAAAGATCCAAAGCATATTGGAAGTCAAGGACCAGTCAGCTGTTGA
rJMFF043O16+ ACATTTAGTTCAGCAAAAGTTCCAAAGCATATTGGAAGTCAAGGACCAGTCAGCTGTTGA
                      ____________________________________________________________
consensus ACATTTAGTTCAGCAAAAGTTCCAAAGCATATTGGAAGTCAAGGACCAGTCAGCTGTTGA
 
. : . : . : . : . : . :
rJMFF003C09+ TAATCAAAGGTTTAGGGCCGAGGTGGGAAAATATTTTGAGTCATTGGAGCTGGAAAAGGT
rJMFF043O16+ TTATCAAAGGTTTAGGGCCGAGGTGGGAAAATATTTTGAGTCATTGGAGCTGGAAAAGGT
                      ____________________________________________________________
consensus TTATCAAAGGTTTAGGGCCGAGGTGGGAAAATATTTTGAGTCATTGGAGCTGGAAAAGGT
 
. : . : . : . : . : . :
rJMFF003C09+ GGAACCCATGGAACGCAAGCAACTGCTGATAAAAGCCCACGGTGAATGGGTTAATAAGAT
rJMFF043O16+ GGAACCCATGGAACGCAAGCAACTGCTGATAAAAGCCCCCGGTGAATGGGTTAATAAGAT
                      ____________________________________________________________
consensus GGAACCCATGGAACGCAAGCAACTGCTGATAAAAGCCCCCGGTGAATGGGTTAATAAGAT
 
. : . : . : . : . : . :
rJMFF003C09+ GAAACAGAGACACCGTGCAGAAGAGGCTGCGGTGGAGGAGGAATTTAATGCTGCATTAAC
rJMFF043O16+ GAAACAGAGACCCCGTGCAGAAGAGGCTGCGGTGGAGGAGGAATTTAATGCTGCATTAAC
                      ____________________________________________________________
consensus GAAACAGAGACCCCGTGCAGAAGAGGCTGCGGTGGAGGAGGAATTTAATGCTGCATTAAC
 
. : . : . : . : . : . :
rJMFF003C09+ TAGGTTGCTTGAGATTTGAGAGGAGAGATTTGTAACTAGTTTATACTCTGCAGTTAATAG
rJMFF043O16+ TAGGTTGCTTGAGATTTGAGAGGAGAGATTTGTAACTAGTTTATACTTTGCAGTTAATAG
                      ____________________________________________________________
consensus TAGGTTGCTTGAGATTTGAGAGGAGAGATTTGTAACTAGTTTATACTTTGCAGTTAATAG
 
. : . : . : . : . : . :
rJMFF003C09+ TTTTGGAACTCCAGAAAATTTTCGTGGAAGTTGAACTATTATATGCTTAT
rJMFF043O16+ TTTTGGAACTCCAGAAAATTTTTGTGGAAGTTGAACTATTATATGCTTATGTTATCCGTG
                      ____________________________________________________________
consensus TTTTGGAACTCCAGAAAATTTTTGTGGAAGTTGAACTATTATATGCTTATGTTATCCGTG