Previous Contig 010367:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043K09Sequence642004455 (5)gb:BT015417_16422451e-66Arabidopsis thaliana At1g12570 gene, complete cds.564010367 (2)gb:OSJN00071_16942951e-43Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019K04, complete seque
JMFF043O09Sequence640004455 (5)gb:BT015417_16422454e-66Arabidopsis thaliana At1g12570 gene, complete cds.606010367 (2)gb:OSJN00071_16942952e-43Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019K04, complete seque

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF043K09+ CAGCG
rJMFF043O09+ ACAGCG
                      ____________________________________________________________
consensus ACAGCG
 
. : . : . : . : . : . :
rJMFF043K09+ TTGCGTGAATGGCATCAGAGTCATCGAATCCATAATCGAATCGAAGCCGTTCGCCAAGTT
rJMFF043O09+ TTGCGTGAATGGCATCAGAGTCATCGAATCCATAATCGAATCGAAGCCGTTCGCCAAGTT
                      ____________________________________________________________
consensus TTGCGTGAATGGCATCAGAGTCATCGAATCCATAATCGAATCGAAGCCGTTCGCCAAGTT
 
. : . : . : . : . : . :
rJMFF043K09+ CCGGCTCGACAACCTTTCCTGGGAGATCCTCTTGAACATGTCCGCCTCGGCGCCGGTGAA
rJMFF043O09+ CCGGCTCGACAACCTTTCCTGGGAGATCCTCTTGAACATGTCCGCCTCGGCGCCGGTGAA
                      ____________________________________________________________
consensus CCGGCTCGACAACCTTTCCTGGGAGATCCTCTTGAACATGTCCGCCTCGGCGCCGGTGAA
 
. : . : . : . : . : . :
rJMFF043K09+ CCTGCTGCCCAAGCACACAAACGCCTCAATATCATTGGAGCAGTTCTGTAGAGACAGCGT
rJMFF043O09+ CCTGCTGCCCAAGCACACAAACGCCTCAATATCATTGGAGCAGTTCTGTAGAGACAGCGT
                      ____________________________________________________________
consensus CCTGCTGCCCAAGCACACAAACGCCTCAATATCATTGGAGCAGTTCTGTAGAGACAGCGT
 
. : . : . : . : . : . :
rJMFF043K09+ GATGACAATCTGGCACTATCATGGAGGTTGCCAGGTCGGCAGAGTTGTTGACCACAATTA
rJMFF043O09+ GATGACAATCTGGCACTATCATGGAGGTTGCCAGGTCGGCAGAGTTGTTGACCACAATTA
                      ____________________________________________________________
consensus GATGACAATCTGGCACTATCATGGAGGTTGCCAGGTCGGCAGAGTTGTTGACCACAATTA
 
. : . : . : . : . : . :
rJMFF043K09+ TAAGGTTTTCGGAGTTAATAACCTTCGAGTCGTTGATGGATCCACGTTTTATTACTCTCC
rJMFF043O09+ TAAGGTTTTCGGAGTTAATAACCTTCGAGTCGTTGATGGATCCACGTTTTATTACTCTCC
                      ____________________________________________________________
consensus TAAGGTTTTCGGAGTTAATAACCTTCGAGTCGTTGATGGATCCACGTTTTATTACTCTCC
 
. : . : . : . : . : . :
rJMFF043K09+ TGGGACTAATCCTCAGGCCACTGTTATGATGCTCGGAAGGTACATGGGAGTACAGATATT
rJMFF043O09+ TGGGACTAATCCTCAGGCCACTGTTATGATGCTCGGAAGGTACATGGGAGTACAGATATT
                      ____________________________________________________________
consensus TGGGACTAATCCTCAGGCCACTGTTATGATGCTCGGAAGGTACATGGGAGTACAGATATT
 
. : . : . : . : . : . :
rJMFF043K09+ GAGGGAAAGACTTGCCAGAAAGAAGTCAAAGTGATGATGCTCTGATCTCGATTTTGTTCT
rJMFF043O09+ GAGGGAAAGACTTGCCAGAAAGAAGTCAAAGTGATGATGCTCTGATCTCGATTTTGTTCT
                      ____________________________________________________________
consensus GAGGGAAAGACTTGCCAGAAAGAAGTCAAAGTGATGATGCTCTGATCTCGATTTTGTTCT
 
. : . : . : . : . : . :
rJMFF043K09+ ATTTATTGTTCTCTCTTCTTTTTCTTTTTTTTTTTTGGTTGAAAAAAATTAAAGCAGGCT
rJMFF043O09+ ATTTATTGTTCTCTCTTCTTTTTCTTTTTTTTTTTTGGTTGAAAAAAATTAAAGCAGGCT
                      ____________________________________________________________
consensus ATTTATTGTTCTCTCTTCTTTTTCTTTTTTTTTTTTGGTTGAAAAAAATTAAAGCAGGCT
 
. : . : . : . : . : . :
rJMFF043K09+ TATGTGATGTTGATGTGTCAAAATAACTATGAACTGTATGCATTTCATTGAATAAAATAG
rJMFF043O09+ TATGTGATGTTGATGTGTCAAAATAACTATGAACTGTATGCATTTCATTGAATAAAATAG
                      ____________________________________________________________
consensus TATGTGATGTTGATGTGTCAAAATAACTATGAACTGTATGCATTTCATTGAATAAAATAG
 
. : . : . : . : . : . :
rJMFF043K09+ AAAAAAGGATTTCTGCAAG
rJMFF043O09+ AAAAAAGGATTTCTGCAAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AAAAAAGGATTTCTGCAAGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG