Previous Contig 010363:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF007B05Sequence575005878 (7)gb:AX063304_14587571e-48Sequence 13 from Patent WO0078799.652010363 (9)gb:AP003346_18284443e-69Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043
JMFF008H02Sequence496005878 (7)gb:AX063304_14587579e-23Sequence 13 from Patent WO0078799.800010363 (9)gb:AX063304_14587576e-98Sequence 13 from Patent WO0078799.
JMFF017I19Sequence479005878 (7)gb:AX063304_14587577e-35Sequence 13 from Patent WO0078799.654010363 (9)gb:AX063304_14587571e-65Sequence 13 from Patent WO0078799.
JMFF029J09Sequence482005878 (7)gb:AX063304_14587573e-35Sequence 13 from Patent WO0078799.740010363 (9)gb:AP003346_18284446e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043
JMFF030H24Sequence551005878 (7)gb:AX063304_14587576e-26Sequence 13 from Patent WO0078799.658010363 (9)gb:AP003346_18284441e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043
JMFF038F20Sequence184010363 (9)
JMFF038O08Sequence763010363 (9)gb:AP003346_18284442e-91Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043
JMFF043N15Sequence635005878 (7)gb:AX063304_14587572e-35Sequence 13 from Patent WO0078799.614010363 (9)gb:AP003346_18284442e-59Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043
JMSF020E05Sequence664005878 (7)gb:AX063304_14587572e-38Sequence 13 from Patent WO0078799.690010363 (9)gb:AP003346_18284447e-81Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P043

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF038O08+ GGTTG
rJMFF008H02+ AAGTACATGATTCGTGCCTTAGAGGATGATTTCAAGACGGTTG
                      ____________________________________________________________
consensus AAGTACATGATTCGTGCCTTAGAGGATGATTTCAAGACGGTTG
 
. : . : . : . : . : . :
rJMFF038O08+ TTGGTATTAGTTGGTATTTGTGGGTATTTGTGGTTATTTTCTTATTGCTGAATATTAATG
rJMSF020E05+ TGAATATTAATG
rJMFF008H02+ TTGGTATTAGTTGGTATTTGTGGGTATTTGTGGTTATTTTCTTATTGCTGAATATTAATG
rJMFF029J09+ GTGGGTATTTGTGGTTATTTTCTTATTGCTGAATATTAATG
                      ____________________________________________________________
consensus TTGGTATTAGTTGGTATTTGTGGGTATTTGTGGTTATTTTCTTATTGCTGAATATTAATG
 
. : . : . : . : . : . :
rJMFF038O08+ GTTGGCATACATATTTTTGGATCGCATTCATCCCTTTCATTCTCCTACTTGCTGTTGGCA
rJMSF020E05+ GTTGGCATACATATTTTTGGATCGCATTCATCCCTTTCATTCTCCTACTTGCTGTTGGCA
rJMFF017I19+ CTACTTGCTGTTGGCA
rJMFF007B05+ TACTTGCTGTTGGCA
rJMFF008H02+ GTTGGCATACATATTTTTGGATCGCATTCATCCCTTTCATTCTCCTACTTGCTGTTGGCA
rJMFF029J09+ GTTGGCATACATATTTTTGGATCGCATTCATCCCTTTCATTCTCCTACTTGCTGTTGGCA
rJMFF030H24+ CCTACTTGCTGTTGGCA
                      ____________________________________________________________
consensus GTTGGCATACATATTTTTGGATCGCATTCATCCCTTTCATTCTCCTACTTGCTGTTGGCA
 
. : . : . : . : . : . :
rJMFF038O08+ CGAAGTTGGAGCACGTAATCATCCAATTGGCTCATGAGGTTGCTGAGAAACATGTTGCCA
rJMSF020E05+ CGAAGTTGGAGCACGTAATCATCCAATTGGCTCATGAGGTTGCTGAGAAACATGTTGCCA
rJMFF017I19+ CGAAGTTGGAGCACGTAATCATCCAATTGGCTCATGAGGTTGCTGAGAAACATGTTGCCA
rJMFF007B05+ CGAAGTTGGAGCACGTAATCATCCAATTGGCTCATGAGGTTGCTGAGAAACATGTTGCCA
rJMFF008H02+ CGAAGTTGGAGCACGTAATCATCCAATTGGCTCATGAGGTTGCTGAGAAACATGTTGCCA
rJMFF029J09+ CGAAGTTGGAGCACGTAATCATCCAATTGGCTCATGAGGTTGCTGAGAAACATGTTGCCA
rJMFF030H24+ CGAAGTTGGAGCACGTAATCATCCAATTGGCTCATGAGGTTGCTGAGAAACATGTTGCCA
rJMFF043N15+ GAGAAACATGTTGCCA
                      ____________________________________________________________
consensus CGAAGTTGGAGCACGTAATCATCCAATTGGCTCATGAGGTTGCTGAGAAACATGTTGCCA
 
. : . : . : . : . : . :
rJMFF038O08+ TAGAGGGTGAATTGGTTGTG-CAACCTTCGGATGAGCACTTTTGGTTTGGTCGGCCTCAA
rJMSF020E05+ TAGAGGGTGAATTGGTTGTG-CAACCTTCGGATGAGCACTTTTGGTTTGGTCGGCCTCAA
rJMFF017I19+ TAGAGGGTGAATTGGTTGTG-CAACCTTCGGATGAGCACTTTTGGTTTGGTCGGCCTCAA
rJMFF007B05+ TAGAGGGTGAATTGGTTGTG-CAACCTTCGGATGAGCACTTTTGGTTTGGTCGGCCTCAA
rJMFF008H02+ TAGAGGGTGAATTGGTTGTG-CAACCTTCGGATGAGCACTTTTGGTTTGGTCGGCCTCAA
rJMFF029J09+ TAGAGGGTGAATTGGTTGTGCCAACCTTCGGATGAGCACTTTTGGTTTGGTCGGCCTCAA
rJMFF030H24+ TAGAGGGTGAATTGGTTGTG-CAACCTTCGGATGAGCACTTTT-GTTTGGTCGGCCTCAA
rJMFF043N15+ TAGAGGGTGAATTGGTTGTG-CAACCTTCGGATGAGCACTTTTGGTTTGGTCGGCCTCAA
                      ____________________________________________________________
consensus TAGAGGGTGAATTGGTTGTG-CAACCTTCGGATGAGCACTTTTGGTTTGGTCGGCCTCAA
 
. : . : . : . : . : . :
rJMFF038O08+ ATTGTTCTGTTCCTGATACACTTCATTCTCTTCCAAAATGCTTTTGAAATAGCGTTTTTC
rJMSF020E05+ ATTGTTCTGTTCCTGATACACTTCATTCTCTTCCAAAATGCTTTTGAAATAGCGTTTTTC
rJMFF017I19+ ATTGTTCTGTTCCTGATACACTTCATTCTCTTCCAAAATGCTTTTGAAATAGCGTTTTTC
rJMFF007B05+ ATTGTTCTGTTCCTGATACACTTCATTCTCTTCCAAAATGCTTTTGAAATAGCGTTTTTC
rJMFF008H02+ ATTGTTCTGTTCCTGATACACTTCATTCTCTTCCAAAATGCTTTTGAAATAGCGTTTTTC
rJMFF029J09+ ATTGTTCTGTTCCTGATACACTTCATTCTCTTCCAAAATGCTTTTGAAATAGCGTTTTTC
rJMFF030H24+ ATTGTTCTGTTCCTGATACACTTCATTCTCTTCCAAAATGCTTTTGAAATAGCGTTTT--
rJMFF043N15+ ATTGTTCTGTTCCTGATACACTTCATTCTCTTCCAAAATGCTTTTGAAATAGCGTTTTTC
                      ____________________________________________________________
consensus ATTGTTCTGTTCCTGATACACTTCATTCTCTTCCAAAATGCTTTTGAAATAGCGTTTTTC
 
. : . : . : . : . : . :
rJMFF038O08+ TTCTGGATTTTGGTGCAATATGGTTTTGATTCCTGCATAATGGGGCACGTTAAATTCATC
rJMSF020E05+ TTCTGGATTTTGGTGCAATATGGTTTTGATTCCTGCATAATGGGGCACGTTAAATTCATC
rJMFF017I19+ TTCTGTATTTTGGTGCAATATGGTTTTGATTCCTGCATAATGGGGCACGTTAAATTCATC
rJMFF007B05+ TTCTGGATTTTGGTGCAATATGGTTTTGATTCCTGCATAATGGGGCACGTTAAATTCATC
rJMFF008H02+ TTCTGGATTTTGGTGCAATATGGTTTTGATTCCTGCATAATGGGGCACGTTAAATTCATC
rJMFF029J09+ TTCTGGATTTTGGTGCAATATGGTTTTGATTCCTGCATAATGGGGCACGTTAAATTCATC
rJMFF030H24+ TTCTGGATTTTGGTGCAATATGGTTTTGATTCCTGCATAATGGGGCACGTTAAATTCATC
rJMFF043N15+ TTCTGGATTTTGGTGCAATATGGTTTTGATTCCTGCATAATGGGGCACGTTAAATTCATC
                      ____________________________________________________________
consensus TTCTGGATTTTGGTGCAATATGGTTTTGATTCCTGCATAATGGGGCACGTTAAATTCATC
 
. : . : . : . : . : . :
rJMFF038O08+ ATCCCTAGGCTCGTCATAGGAGTAATTATTCAGGTGCTTTGCAGCTATAGCACACTGCCT
rJMSF020E05+ ATCCCTAGGCTCGTCATAGGAGTAATTATTCAGGTGCTTTGCAGCTATAGCACACTGCCT
rJMFF017I19+ ATCCCTAGGCTCGTCATAGGAGTAATTATTCAGGTGCTTTGCAGCTATAGCACACTGCCT
rJMFF007B05+ ATCCNTAGGCTCGTCATAGGAGTAATTATTCAGGTGCTTTGCAGCTATAGCACACTGCCT
rJMFF008H02+ ATCCCTAGGCTCGTCATAGGAGTAATTATTCAGGTGCTTTGCAGCTATAGCACACTGCCT
rJMFF029J09+ ATCCCTAGGCTCGTCATAGGAGTAATTATTCAGGTGCTTTGCAGCTATAGCACACTGCCT
rJMFF030H24+ ATCCCTAGGCTCGTCATAGGAGTAATTATTCAGGTGCTTTGCAGCTATAGCACACTGCCT
rJMFF043N15+ ATCCCTAGGCTCGTCATAGGAGTAATTATTCAGGTGCTTTGCAGCTATAGCACACTGCCT
                      ____________________________________________________________
consensus ATCCCTAGGCTCGTCATAGGAGTAATTATTCAGGTGCTTTGCAGCTATAGCACACTGCCT
 
. : . : . : . : . : . :
rJMFF038O08+ ATCTATGCTATAGTTACACAGATGGGAACCCATTTCAAGAAATCGATATTTGATGAGCAC
rJMSF020E05+ ATCTATGCTATAGTTACACAGATGGGAACCCATTTCAAGAAATCGATATTTGATGAGCAC
rJMFF017I19+ ATCTATGCTATAGTTACACAGATGGGAACCCATTTCAAGAAATCGATATTTGATGAGCAC
rJMFF007B05+ ATCTATGNTATAGTTACACAGATGGGAACCCATTTCAAGAAATCGATATTTGATGAGCAC
rJMFF008H02+ ATCTATGCTATAGTTACACAGATGGGAACCCATTTCAAGAAATCGATATTTGATGAGCAC
rJMFF029J09+ ATCTATGCTATAGTTACACAGATGGGAACCCATTTCAAGAAATCGATATTTGATGAGCAC
rJMFF030H24+ ATCTATGCTATAGTTACACAGATGGGAACCCATTTCAAGAAATCGATATTTGATGAGCAC
rJMFF043N15+ ATCTATGCTATAGTTACACAGATGGGAACCCATTTCAAGAAATCGATATTTGATGAGCAC
                      ____________________________________________________________
consensus ATCTATGCTATAGTTACACAGATGGGAACCCATTTCAAGAAATCGATATTTGATGAGCAC
 
. : . : . : . : . : . :
rJMFF038O08+ ATCCAAGTTGGGCTCGTCGGTTGGGCTCAGAAGGCGAAACAAAGGAAGGGACTGAAAGCG
rJMSF020E05+ ATCCAAGTTGGGCTCGTCGGTTGGGCTCAGAAGGCGAAACAAAGGAAGGGACTGAAAGCG
rJMFF017I19+ ATCCAAGTTGGGCTCGTCGGTTGGGCTCAGAAGGCGAAACAAAGGAAGGGACTGAAAGCG
rJMFF007B05+ ATCCAAGTTGGGCTCGTCGGTTGGGCTCAGAAGGCGAAACAAAGGAAGGGACTGAAAGCG
rJMFF008H02+ ATCCAAGTTGGGCTCGTCGGTTGGGCTCAGAAGGCGAAACAAAGGAAGGGACTGAAAGCG
rJMFF029J09+ ATCCAAGTTGGGCTCGTCGGTTGGGCTCAGAAGGCGAAACAAAGGAAGGGACTGAAAGCG
rJMFF030H24+ ATCCAAGTTGGGCTCGTCGGTTGGGCTCAGAAGGCGAGACAAAGGAAGGGACTGAAAGCG
rJMFF043N15+ GTCCAAGTTGGGCTCGTCGGTTGGGCTCAGAAGGCGAAACAAAGGAAGGGACTGAAAGCG
                      ____________________________________________________________
consensus ATCCAAGTTGGGCTCGTCGGTTGGGCTCAGAAGGCGAAACAAAGGAAGGGACTGAAAGCG
 
. : . : . : . : . : . :
rJMFF038O08+ GCATTTGGTGGCATCAATCAC-GGGGGGGCTTTGACGGATGGTTCCTCGACGGGAGTGCA
rJMSF020E05+ GCATTTGGTGGCATCAATCAC-GGGGGGGCTTTGACGGATGGTTCCTCGACGGGAGTGCA
rJMFF017I19+ GCATTTGGTGGCATCAATCACGGGGGGGGCTTTGACGGATGGTTCCTCGACGGGAGTGCA
rJMFF038F20+ CGGATGGTTCCTCGACGGGAGTGCA
rJMFF007B05+ GCATTTGGTGGCATCAATCAC-GGGGGGGCTTTGACGGATGGTTCCTCGACGGGAGTGCA
rJMFF008H02+ GCATTTGGTGGCATCAATCAC-GGGGGGGCTTTGACGGATGGTTCCTCGACGGGAGTGCA
rJMFF029J09+ GCATTTGGTGGCATCAATCAC-GGGGGGGCTTTGACGGATGGTTCCTCGACGGGAGTGCA
rJMFF030H24+ GCATTTGGTGGCATCAATCAC-GGGGGGGCTTTGACGGATGGTTCCTCGACGGGAGTGCA
rJMFF043N15+ GCATTTGGTGGCATCAATCAC-GGGGGGGCTTTGACGGATGGTTCCTCGACGGGAGTGCA
                      ____________________________________________________________
consensus GCATTTGGTGGCATCAATCAC-GGGGGGGCTTTGACGGATGGTTCCTCGACGGGAGTGCA
 
. : . : . : . : . : . :
rJMFF038O08+ GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTCTGTCAGAGCGCT
rJMSF020E05+ GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTCTGTCAGAGCGCT
rJMFF017I19+ GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTCTGTCAGAGCGCT
rJMFF038F20+ GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTNCGTCAGAGCGCT
rJMFF007B05+ GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTCTGTCAGAGCGCT
rJMFF008H02+ GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTCTGTCAGAGCGCT
rJMFF029J09+ GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTCTGTCAGAGCGCT
rJMFF030H24+ GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTCTGTCAGAGCGCT
rJMFF043N15+ GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTCTGTCAGAGCGCT
                      ____________________________________________________________
consensus GATGGGAGGCGTTGGACGCAAGGAATCTGGCTCGACTGATGGTGCCTCTGTCAGAGCGCT
 
. : . : . : . : . : . :
rJMFF038O08+ GCAGCAGATGGGAGGCGATGGGAGTAAGTAATGTACAAACTAGCTATAGAACAATCATTG
rJMSF020E05+ GCAGCAGATGGGAGGCGATGGGAGTAAGTAATGTACAAACTAGCTATAGAACAATCATTG
rJMFF017I19+ GCAGCAGATGGGAGGCGATGGGAGTAAGTAATGTACAAACTAGCTATAGAACAATCATTG
rJMFF038F20+ GCAGCAGATGGGAGGCGATGGGAGTAAGTAANGTACAANCTANNTATAGAACAATCANTG
rJMFF007B05+ GCAGCAGATGGGAGGCGATGGGAGTAAGTAATGTACAAACTAGCTATAGAACAATCATTG
rJMFF008H02+ GCAGCAGATGGGAGGCGATGGGAGTAAGTAATGTACAAACTAGCTATAGAACAATCATTG
rJMFF029J09+ GCAGCAGATGGGAGGCGATGGGAGTAAGTAATGTACAAACTAGCTATAGAACAATCATTG
rJMFF030H24+ GCAGCAGATGGGAGGCGATGGGAGTAAGTAATGTACAAACTAGCTATAGAACAATCATTG
rJMFF043N15+ GCAGCAGATGGGAGGCGATGGGAGTAAGTAATGTACAAACTAGCTATAGAACAATCATTG
                      ____________________________________________________________
consensus GCAGCAGATGGGAGGCGATGGGAGTAAGTAATGTACAAACTAGCTATAGAACAATCATTG
 
. : . : . : . : . : . :
rJMFF038O08+ TGGGCAAGGTAAGGTTATGGGATGATGAGTATATCAAA
rJMSF020E05+ TGGGCAAGGTAAGGTTATGG
rJMFF017I19+ TGGGCAAGGTAAGGTTATGGGATGATGAGTATATCAAAT
rJMFF038F20+ TGGGCAAGGTAAGGTTATGGGATGATGAGTATA
rJMFF007B05+ TGGGCAAGGTAAGGTTATGGGATGATGAGTATATCA
rJMFF008H02+ TGGGCAAGGTAAGGTTATGGGATGATGAGTATATCAAAT
rJMFF029J09+ TGGGCAAGGTAAGGTTATGGGATGATGAGTATATCAAAT
rJMFF030H24+ TGGGCAAGGTAAGGTTATGGGATGATGAGTATATCAAAT
rJMFF043N15+ TGGGCAAGGTAAGGTTATGGGATGATGAGTATATCAAATGGAAACCTGATACTTTATTGC
                      ____________________________________________________________
consensus TGGGCAAGGTAAGGTTATGGGATGATGAGTATATCAAATGGAAACCTGATACTTTATTGC