Previous Contig 010362:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004A13Sequence210005915 (8)670010362 (9)gb:AB011482_15114693e-47Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412
JMFF015P22Sequence536005915 (8)gb:AB011482_15114697e-30Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412719010362 (9)gb:AB011482_15114692e-63Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412
JMFF018D05Sequence535005915 (8)gb:AB011482_15114692e-32Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412731010362 (9)gb:AB011482_15114692e-56Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412
JMFF043N10Sequence643005915 (8)gb:AB011482_15114691e-42Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412601010362 (9)gb:AB011482_15114691e-42Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412
JMSF012N11Sequence488005915 (8)gb:AB011482_15114698e-24Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412754010362 (9)gb:AB011482_15114699e-64Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412
JMSF020K06Sequence633005915 (8)gb:AB011482_15114691e-42Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412799010362 (9)gb:AB011482_15114693e-66Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412
JMSF033A09Sequence680005915 (8)gb:AB011482_15114696e-51Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412729010362 (9)gb:AB011482_15114691e-62Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412
JMSF041B24Sequence673010362 (9)gb:AB011482_15114696e-67Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412
JMSF041C24Sequence643010362 (9)gb:AB011482_15114694e-50Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MUA2.>gb:BT011690_16412

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF041B24- GACAGAGTTTAGTAATGATGGATCAACACTGAGAGAGGATTTCG
                      ____________________________________________________________
consensus GACAGAGTTTAGTAATGATGGATCAACACTGAGAGAGGATTTCG
 
. : . : . : . : . : . :
JMSF041B24- AAGGGATTAATGATGCGTGGGGTGGTGGATTGGATGCCTCAGAGTATGTGGGAACAAAGA
                      ____________________________________________________________
consensus AAGGGATTAATGATGCGTGGGGTGGTGGATTGGATGCCTCAGAGTATGTGGGAACAAAGA
 
. : . : . : . : . : . :
JMSF041B24- AAATTAAGAAAGATCAAGGGCTTGGTGGGCTTGAGTTATTGGCAACTAGTGAGCCTCCTA
                      ____________________________________________________________
consensus AAATTAAGAAAGATCAAGGGCTTGGTGGGCTTGAGTTATTGGCAACTAGTGAGCCTCCTA
 
. : . : . : . : . : . :
JMSF041B24- AAACTGAAGCTGGAGCTCCTGCTGAGGGTGATGCTGGCAAGAATCTTGAGGACATTTTGG
                      ____________________________________________________________
consensus AAACTGAAGCTGGAGCTCCTGCTGAGGGTGATGCTGGCAAGAATCTTGAGGACATTTTGG
 
. : . : . : . : . : . :
JMSF041B24- TGAAGAAGATGAAGGGTCCGGAGATGTACATTACAGAAGANATCAGTGCAGAGTTTAGGG
                      ____________________________________________________________
consensus TGAAGAAGATGAAGGGTCCGGAGATGTACATTACAGAAGANATCAGTGCAGAGTTTAGGG
 
. : . : . : . : . : . :
JMSF041B24- AGTCATTGCTTTCTAGAGTTGGATTGATGGGCACTATCTACTTAAAGACAATGCCGCCTC
                      ____________________________________________________________
consensus AGTCATTGCTTTCTAGAGTTGGATTGATGGGCACTATCTACTTAAAGACAATGCCGCCTC
 
. : . : . : . : . : . :
JMSF041B24- AAAAACCATCTGATGACAAAGAAACTGAGTTTTCATTCAAGGTTGATGGGACTGGTGGAG
rJMSF033A09+ TCAAGGTTGATGGGACTGGTGGAG
rJMFF015P22+ CATTCAAGGTTGATGGGACTGGTGGAG
rJMSF012N11+ CATTCAAGGTTGATGGGACTGGTGGAG
rJMSF020K06+ AAAACCATCTGATGCC-AAGAAACTGAGTTTTCATTCAAGGTTGATGGGACTGGTGGAG
                      ____________________________________________________________
consensus AAAAACCATCTGATGCCAAAGAAACTGAGTTTTCATTCAAGGTTGATGGGACTGGTGGAG
 
. : . : . : . : . : . :
JMSF041B24- TTAAGAGATTTGTTATGCANAACTCCCTAGTGAGTAGCCTTGGAAATGGGATGTTTCATG
rJMSF033A09+ TTAAGAGATTTGTTATGCAAAACTCCCTAGTGAGTAGCCTTGGAAATGGGATGTTTCATG
rJMFF015P22+ TTAAGAGATTTGTTATGCAAAACTCCCTAGTGAGTAGCCTTGGAAATGGGATGTTTCATG
rJMSF012N11+ TTAAGAGATTTGTTATGCAAAACTCCCTAGTGAGTAGCCTTGGAAATGGGATGTTTCATG
rJMSF020K06+ TTAAGAGATTTGTTATGCAAAACTCCCTAGTGAGTAGCCTTGGAAATGGGATGTTTCATG
rJMFF018D05+ TGAGTAGCCTTGGAAATGGGATGTTTCATG
                      ____________________________________________________________
consensus TTAAGAGATTTGTTATGCAAAACTCCCTAGTGAGTAGCCTTGGAAATGGGATGTTTCATG
 
. : . : . : . : . : . :
JMSF041B24- TGAAGACTACACCTTCGAATGAGCCTATTCCAATTATCAAGTACAGCTTGCTACCACGCT
rJMSF033A09+ TGAAGACTACACCTTCGAATGAGCCTATTCCAATTATCAAGTACAGCTTGCTACCACGCT
rJMFF015P22+ TGAAGACTACACCTTCGAATGAGCCTATTCCAATTATCAAGTACAGCTTGCTACCACGCT
rJMSF012N11+ TGAAGACTACACCTTCGAATGAGCCTATTCCAATTATCAAGTACAGCTTGCTACCACGCT
rJMSF020K06+ TGAAGACTACACCTTCGAATGAGCCTATTCCAATTATCAAGTACAGCTTGCTACCACGCT
rJMSF041C24+ ATCAAGTACAGCTTGCTACCACGCT
rJMFF004A13+ TATTCCAATTATCAAGTACAGCTTGCTACCACGCT
rJMFF018D05+ TGAAGACTACACCTTCGAATGAGCCTATTCCAATTATCAAGTACAGCTTGCTACCACGCT
                      ____________________________________________________________
consensus TGAAGACTACACCTTCGAATGAGCCTATTCCAATTATCAAGTACAGCTTGCTACCACGCT
 
. : . : . : . : . : . :
JMSF041B24- TAACACCATTGCCTTTGAGGGTTCGTCTTGTTCAACGCCTCANTGGAACATTACTCTCTG
rJMSF033A09+ TAACACCATTGCCTTTGAGGGTTCGTCTTGTTCAACGCCTCAGTGGAACATTACTCTCTG
rJMFF015P22+ TAACACCATTGCCTTTGAGGGTTCGTCTTGTTCAACGCCTCAGTGGAACATTACTCTCTG
rJMSF012N11+ TAACACCATTGCCTTTGAGGGTTCGTCTTGTTCAACGCCTCAGTGGAACATTACTCTCTG
rJMSF020K06+ TAACACCATTGCCTTTGAGGGTTCGTCTTGTTCAACGCCTCAGTGGAACATTACTCTCTG
rJMSF041C24+ TAACACCATTGCC-TTGAGGGTTCGTCTTGTTCAACGCCTCAGTGGAACATTACTCTCTG
rJMFF004A13+ TAACACCATTGCCTTTGAGGGTTCGTCTTGTTCAACGCCTCAGTGGAACATTACTCTCTG
rJMFF018D05+ TAACACCATTGCCTTTGAGGGTTCGTCTTGTTCAACGCCTCAGTGGAACATTACTCTCTG
rJMFF043N10+ G
                      ____________________________________________________________
consensus TAACACCATTGCCTTTGAGGGTTCGTCTTGTTCAACGCCTCAGTGGAACATTACTCTCTG
 
. : . : . : . : . : . :
JMSF041B24- TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
rJMSF033A09+ TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
rJMFF015P22+ TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
rJMSF012N11+ TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
rJMSF020K06+ TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
rJMSF041C24+ TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
rJMFF004A13+ TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
rJMFF018D05+ TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
rJMFF043N10+ TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
                      ____________________________________________________________
consensus TGATGCTGCAGTATGTGTCAAACCCAGATCTGCCAGCTCCTTTAACTAATGTGACTTTTG
 
. : . : . : . : . : . :
JMSF041B24- TTCTGAAGCTTCCTGTGGATCCAACCTTA
rJMSF033A09+ TTCTGAAGCTTCCTGTGGATCCAACCTTAGTAAAGGTTTCCCCAAAAGCTGTACTGAACA
rJMFF015P22+ TTCTGAAGCTTCCTGTGGATCCAACCTTAGTAAAGGTTTCCCCAAAAGCTGTACTGAACA
rJMSF012N11+ TTCTGAAGCTTCCTGTGGATCCAACCTTAGTAAAGGTTTCCCCAAAAGCTGTACTGAACA
rJMSF020K06+ TTCTGAAGCTTCCTGTGGATCCAACCTTAGTAAAGGTTTCCCCAAAAGCTGTACTGAACA
rJMSF041C24+ TTCTGAAGCTTCCTGTGGATCCAACCTTAGTAAAGGTTTCCCCAAAAGCTGTACTGAACA
rJMFF004A13+ TTCTGAAGCTTCCTGTGGATCCAACCTTAGTAAAGGTTTCCCCAAAAGCTGTACTGAACA
rJMFF018D05+ TTCTGAAGCTTCCTGTGGATCCAACCTTAGTAAAGGTTTCCCCAAAAGCTGTACTGAACA
rJMFF043N10+ TTCTGAAGCTTCCTGTGGATCCAACCTTAGTAAAGGTTTCCCCAAAAGCTGTACTGAACA
                      ____________________________________________________________
consensus TTCTGAAGCTTCCTGTGGATCCAACCTTAGTAAAGGTTTCCCCAAAAGCTGTACTGAACA
 
. : . : . : . : . : . :
rJMSF033A09+ GGTCTGAGAAAGAACTAAAATGGCATATAGAAGAGATCCCACTGAAGGGCAATCCTGGTA
rJMFF015P22+ GGTCTGAGAAAGAACTAAAATGGCATATAGAAGAGATCCCACTGAAGGGCAATCCTGGTA
rJMSF012N11+ GGTCTGAGAAAGAACTAAAATGGCATATAGAAGAGATCCCACTGAAGGGCAATCCTGGTA
rJMSF020K06+ GGTCTGAGAAAGAACTAAAATGGCATATAGAAGAGATCCCACTGAAGGGCAATCCTGGTA
rJMSF041C24+ GGTCTGAGAAAGAACTAAAATGGCATATAGAAGAGATCCCACTGAAGGGCAATCCTGGTA
rJMFF004A13+ GGTCTGAGAAAGAACTAAAATGGCATATAGAAGAGATCCCACTGAAGGGCAATCCTGGTA
rJMFF018D05+ GGTCTGAGAAAGAACTAAAATGGCATATAGAAGAGATCCCACTGAAGGGCAATCCTGGTA
rJMFF043N10+ GGTCTGAGAAAGAACTAAAATGGCATATAGAAGAGATCCCACTGAAGGGCAATCCTGGTA
                      ____________________________________________________________
consensus GGTCTGAGAAAGAACTAAAATGGCATATAGAAGAGATCCCACTGAAGGGCAATCCTGGTA
 
. : . : . : . : . : . :
rJMSF033A09+ GGTTGAGGGCTAGGTTTCCAGTGGATATTAGTGATGAAGATAATATTGAAGAACTTGAGG
rJMFF015P22+ GGTTGAGGGCTAGGTTTCCAGTGGATATTAGTGATGAAGATAATATTGAAGAACTTGAGG
rJMSF012N11+ GGTTGAGGGCTAGGTTTCCAGTGGATATTAGTGATGAAGATAATATTGAAGAACTTGAGG
rJMSF020K06+ GGTTGAGGGCTAGGTTTCCAGTGGATATTAGTGATGAAGATAATATTGAAGAACTTGAGG
rJMSF041C24+ GGTTGAGGGCTAGGTTTCCAGTGGATATTAGTGATGAAGATAATATTGAAGAACTTGAGG
rJMFF004A13+ GGTTGAGGGCTAGGTTTCCAGTGGATATTAGTGATGAAGATAATATTGAAGAACTTGAGG
rJMFF018D05+ GGTTGAGGGCTAGGTTTCCAGTGGATATTAGTGATGAAGATAATATTGAAGAACTTGAGG
rJMFF043N10+ GGTTGAGGGCTAGGTTTCCAGTGGATATTAGTGATGAAGATAATATTGAAGAACTTGAGG
                      ____________________________________________________________
consensus GGTTGAGGGCTAGGTTTCCAGTGGATATTAGTGATGAAGATAATATTGAAGAACTTGAGG
 
. : . : . : . : . : . :
rJMSF033A09+ TCGTTGGTTTTGTAAAGTTTTCTAAGCAAGGAGCTAGATCATTGTCAGGCATCTCTTTGC
rJMFF015P22+ TCGTTGGTTTTGTAAAGTTTTCTAAGCAAGGAGCTAGATCATTGTCAGGCATCTCTTTGC
rJMSF012N11+ TCGTTGGTTTTGTAAAGTTTTCTAAGCAAGGAGCTAGATCATTGTCAGGCATCTCTTTGC
rJMSF020K06+ TCGTTGGTTTTGTAAAGTTTTCTAAGCAAGGAGCTAGATCATTGTCAGGCATCTCTTTGC
rJMSF041C24+ TCGTTGGTTTTGTAAAGTTTTCTAAGCAAGGAGCTAGATCATTGTCAGGCATCTCTTTGC
rJMFF004A13+ TCGTTGGTTTTGTAAAGTTTTCTAAGCAAGGAGCTAGATCATTGTCAGGCATCTCTTTGC
rJMFF018D05+ TCGTTGGTTTTGTAAAGTTTTCTAAGCAAGGAGCTAGATCATTGTCAGGCATCTCTTTGC
rJMFF043N10+ TCGTTGGTTTTGTAAAGTTTTCTAAGCAAGGAGCTAGATCATTGTCAGGCATCTCTTTGC
                      ____________________________________________________________
consensus TCGTTGGTTTTGTAAAGTTTTCTAAGCAAGGAGCTAGATCATTGTCAGGCATCTCTTTGC
 
. : . : . : . : . : . :
rJMSF033A09+ TGCCTGCAATTGAGGGTAAGACAGACTTTTATGAGGTCGATCACAGGTATGCAAGTGGGA
rJMFF015P22+ TGCCTGCAATTGAGGGTAAGACAGACTTTTATGAGGTCGATCACAGGTATGCAAGTGGGA
rJMSF012N11+ TGCCTGCAATTGAGGGTAAGACAGACTTTTATGAGGTCGATCACAGGTATGCAAGTGGGA
rJMSF020K06+ TGCCTGCAATTGAGGGTAAGACAGACTTTTATGAGGTCGATCACAGGTATGCAAGTGGGA
rJMSF041C24+ TGCCTGCAATTGAGGGTAAGACAGACTTTTATGAGGTCGATCACAGGTATGCAAGTGGGA
rJMFF004A13+ TGCCTGCAATTGAGGGTAAGACAGACTTTTATGAGGTCGATCACAGGTATGCAAGTGGGA
rJMFF018D05+ TGCCTGCAATTGAGGGTAAGACAGACTTTTATGAGGTCGATCACAGGTATGCAAGTGGGA
rJMFF043N10+ TGCCTGCAATTGAGGGTAAGACAGACTTTTATGAGGTCGATCACAGGTATGCAAGTGGGA
                      ____________________________________________________________
consensus TGCCTGCAATTGAGGGTAAGACAGACTTTTATGAGGTCGATCACAGGTATGCAAGTGGGA
 
. : . : . : . : . : . :
rJMSF033A09+ ATTACATTTGCAACTAAACATTCATTTTGTTCTTTGTTTACAAATTGTATGTCCTCTTGT
rJMFF015P22+ ATTACATTTGCAACTAAACATTCATTTTGTTCTTTGTTTACAAATTGTATGTCCTCTTGT
rJMSF012N11+ ATTACATTTGCAACTAAACATTCATTTTGTTCTTTGTTTACAAATTGTATGTCCTCTTGT
rJMSF020K06+ ATTACATTTGCAACTAAACATTCATTTTGTTCTTTGTTTACAAATTGTATGTCCTCTTGT
rJMSF041C24+ ATTACATTTGCAACTAAACATTCATTTTGTTCTTTGTTTACAAATTGTATGTCCTCTTGT
rJMFF004A13+ ATTACATTTGCAACTAAACATTCATTTTGTTCTTTGTTTACAAATTGTATGTCCTCTTGT
rJMFF018D05+ ATTACATTTGCAACTAAACATTCATTTTGTTCTTTGTTTACAAATTGTATGTCCTCTTGT
rJMFF043N10+ ATTACATTTGCAACTAAACATTCATTTTGTTCTTTGTTTACAAATTGTATGTCCTCTTGT
                      ____________________________________________________________
consensus ATTACATTTGCAACTAAACATTCATTTTGTTCTTTGTTTACAAATTGTATGTCCTCTTGT
 
. : . : . : . : . : . :
rJMSF033A09+ TTTTATTTTCTTCACAATGAGGTTTTGATTTGAAAATACTTGTAGGTCTATTTGAGTGTG
rJMFF015P22+ TTTTATTTTCTTCACAATGAGGTTTTGATTTGAAAATACTTGTAGGTCTATTTGAGTGTG
rJMSF012N11+ TTTTATTTTCTTCACAATGAGGTTTTGATTTGAAAATACTTGTAGGTCTATTTGAGTGTG
rJMSF020K06+ TTTTATTTTCTTCACAATGAGGTTTTGATTTGAAAATACTTGTAGGTCTATTTGAGTGTG
rJMSF041C24+ TTTTATTTTCTTCACAATGAGGTTTTGATTTGAAAATACTTGTAGGTCTATTTGAGTGTG
rJMFF004A13+ TTTTATTTTCTTCACAATGAGGTTTTGATTTGAAAATACTTGTAGGTCTATTTGAGTGTG
rJMFF018D05+ TTTTATTTTCTTCACAATGAGGTTTTGATTTGAAAATACTTGTAGGTCTATTTGAGTGTG
rJMFF043N10+ TTTTATTTTCTTCACAATGAGGTTTTGATTTGAAAATACTTGTAGGTCTATTTGAGTGTG
                      ____________________________________________________________
consensus TTTTATTTTCTTCACAATGAGGTTTTGATTTGAAAATACTTGTAGGTCTATTTGAGTGTG
 
. : . : . : . : . : . :
rJMSF033A09+ ACATGTAACAAAGACAAATTCTTCTATTTGGTGTGTGTT
rJMFF015P22+ ACATGTAACAAAGACAAATTCTTCTATTTGGT
rJMSF012N11+ ACATGTAACAAAGACAAATTCTTCTATTTGGTGTGTGTTTAAATTTGTCTGGCTTTTAGC
rJMSF020K06+ ACATGTAACAAAGACAAATTCTTCTATTTGGTGTGTGTTTAAATTTGTCTGGCTTTTAGC
rJMSF041C24+ ACATGTAACAAAGACAAATTCTTCTATTTGGTGTGTGTTTAAATTTGTCTGGCTTTTAGC
rJMFF004A13+ ACATGTAACAAAGACAAATTCTTCTATTTGGTGTGTGTTTAAATTTGTCTGGCTTTTAGC
rJMFF018D05+ ACATGTAACAAAGACAAATTCTTCTATTTGGTGTGTGTTTAAATTTGTCTGGCTTTTAGC
rJMFF043N10+ ACATGTAACAAAGACAAATTCTTCTATTTGGTGTGTGTTTAAATTTGTCTGGCTTTTAGC
                      ____________________________________________________________
consensus ACATGTAACAAAGACAAATTCTTCTATTTGGTGTGTGTTTAAATTTGTCTGGCTTTTAGC
 
. : . : . : . : . : . :
rJMSF012N11+ TTATG
rJMSF020K06+ TTATGTTATGGACTTATG
rJMSF041C24+ TTATGTTATGGAC
rJMFF004A13+ TTATGTTATGGACTTATGGTGAACAAACTT
rJMFF018D05+ TTATGTTATGGACTTATGGTGAACAAACTT
rJMFF043N10+ TTATGTTATGGACTTATGGTGAACAAACTTTGCACAAATTCTGTTATAGTTCTTGCATCC
                      ____________________________________________________________
consensus TTATGTTATGGACTTATGGTGAACAAACTTTGCACAAATTCTGTTATAGTTCTTGCATCC