Previous Contig 010360:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF012D11Sequence602003377 (30)gb:AY221087_15905338e-48Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.760010360 (8)gb:AY221087_15905334e-57Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.
JMFF017G07Sequence545010466 (17)gb:AY221087_1590533e-100Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.517010360 (8)gb:AY483152_16082403e-13Hordeum vulgare putative cellulose synthase catalytic subunit (CesA2) mRNA, comp
JMFF022E19Sequence404003377 (30)gb:AY221087_15905334e-10Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.581010360 (8)gb:AY221087_15905333e-29Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.
JMFF035C17Sequence570003377 (30)gb:AY221087_15905339e-35Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.716010360 (8)gb:AY221087_15905332e-48Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.
JMFF037B20Sequence226010360 (8)gb:AF150630_17725603e-08Gossypium hirsutum cellulose synthase catalytic subunit (celA3) mRNA, complete c
JMFF043N06Sequence666003377 (30)gb:AY221087_1590533e-109Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.574010360 (8)gb:AF150630_17725602e-22Gossypium hirsutum cellulose synthase catalytic subunit (celA3) mRNA, complete c
JMFF045A04Sequence634014993gb:AY221087_15905332e-50Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.463010360 (8)gb:AF150630_17725603e-18Gossypium hirsutum cellulose synthase catalytic subunit (celA3) mRNA, complete c
JMSF047A02Sequence695003377 (30)gb:AY221087_15905335e-64Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.756010360 (8)gb:AY221087_15905332e-55Solanum tuberosum cellulose synthase (StCesA3) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF012D11+ AAGGCGTC
rJMSF047A02+ GTC
                      ____________________________________________________________
consensus AAGGCGTC
 
. : . : . : . : . : . :
rJMFF012D11+ AGATGAAGATGGGGACTTTGCAGAACTCTACCTGTTCAAATGGACTACTCTTTTGATACC
rJMFF035C17+ TCAAATGGACTACTCTTTTGATACC
rJMSF047A02+ AGATGNAGATGGGGACTTTGCAGAACTCTACCTGTTCAAATGGACTACTCTTTTGATACC
                      ____________________________________________________________
consensus AGATGAAGATGGGGACTTTGCAGAACTCTACCTGTTCAAATGGACTACTCTTTTGATACC
 
. : . : . : . : . : . :
rJMFF012D11+ TCCTACAACACTCCTCATCATAAATCTGGTGGGTGTTGTTGCTGGAATCTCATATGCCGT
rJMFF035C17+ TCNTACAACACTCCTCATCATAAATCTGGTGGGTGTTGTTGCTGGAATCTCATATGCCGT
rJMSF047A02+ TCCTACAACACTCCTCATCATAAATCTGGTGGGTGTTGTTGCTGGAATCTCATATGCCGT
                      ____________________________________________________________
consensus TCCTACAACACTCCTCATCATAAATCTGGTGGGTGTTGTTGCTGGAATCTCATATGCCGT
 
. : . : . : . : . : . :
rJMFF012D11+ CAACAGTGGTTACCAGTCATGGGGTCCTCTCTTCGGAAAACTATTCTTCGCCTTCTGGGT
rJMFF017G07+ GCCTTCTGGGT
rJMFF035C17+ CAACAGTGGTTACCAGTCATGGGGTCCTCTCTTCGGAAAACTATTCTTCGCCTTCTGGGT
rJMSF047A02+ CAACAGTGGTTACCAGTCATGGGGTCCTCTCTTCGGAAAACTATTCTTCGCCTTCTGGGT
rJMFF022E19+ TGGGT
                      ____________________________________________________________
consensus CAACAGTGGTTACCAGTCATGGGGTCCTCTCTTCGGAAAACTATTCTTCGCCTTCTGGGT
 
. : . : . : . : . : . :
rJMFF045A04+ GCCAGAACCGTACACCCA-
rJMFF012D11+ GATTGTTCATCTCTACCCTTTCCTCAAAGGTCTCATGGGGCGCCAGAACCGTACACCCA-
rJMFF017G07+ GATNGTTCATCTCTNCCCTTTCCTCAAAGGTCTCATGGGGCGCCAGAACCGTACACCCAC
rJMFF035C17+ GATTGTTCATCTCTACCCTTTCCTCAAAGGTCTCATGGGGCGCCAGAACCGTACACCCA-
rJMSF047A02+ GATTGTTCATCTCTACCCTTTCCTCAAAGGTCTCATGGGGCGCCAGAACCGTACACCCA-
rJMFF022E19+ GATTGTTCATCTCTACCCTTTCCTCAAAGGTCTCATGGGGCGCCAGAACCGTACACCCA-
rJMFF043N06+ CAAAGGTCTCATGGGGCGCCAGAACCGTACACCCA-
                      ____________________________________________________________
consensus GATTGTTCATCTCTACCCTTTCCTCAAAGGTCTCATGGGGCGCCAGAACCGTACACCCA-
 
. : . : . : . : . : . :
rJMFF045A04+ CTATGGTCGTGGTGTGGTCTATTTTTCTTGCCTCCATTTTCTCTTTGTTATGGGTGAGGA
rJMFF037B20+ CTCCATTTTCTNTTTGTTATGGGTGAGGA
rJMFF012D11+ CTATTGTCGTTGTGTGGTCTATTCTTCTTGCCTCCATTTTCTCTTTGTTATGGGTGAGGA
rJMFF017G07+ CTATTGTCGTTGTGTGGTCTATTCTTCTTGCCTCCATTTTCTCTTTGTTATGGGTGAGGA
rJMFF035C17+ CTATTGTCGTTGTGTGGTCTATTCTTCTTGCCTCCATTTTCTCTTTGTTATGGGTGAGGA
rJMSF047A02+ CTATTGTCGTTGTGTGGTCTATTCTTCTTGCCTCCATTTTCTCTTTGTTATGGGTGAGGA
rJMFF022E19+ CTATTGTCGTTGTGTGGTCTATTCTTCTTGCCTCCATTTTCTCTTTGTTATGGGTGAGGA
rJMFF043N06+ CTATTGTCGTTGTGTGGTCTATTCTTCTTGCCTCCATTTTCTCTTTGTTATGGGTGAGGA
                      ____________________________________________________________
consensus CTATTGTCGTTGTGTGGTCTATTCTTCTTGCCTCCATTTTCTCTTTGTTATGGGTGAGGA
 
. : . : . : . : . : . :
rJMFF045A04+ TCGATCCATTCACTA-CTAGGGTTACAGGCCCAGACGTTCAGGAGTGTGGTATTAATTGC
rJMFF037B20+ TCGATCCATTCACTA-CTAGGGTTACAGGCCCAGACGTTCAGGAGTGTGGTATTAATTGN
rJMFF012D11+ TCGATCCATTCACTA-CTAGGGTTACAGGCCCAGACGTTCAGGAGTGTGGTATTAATTGC
rJMFF017G07+ TNGATCCATTCANTACCTAGGGTTACAGGCCCAGACGTTCAGGAGTGTGGTANTAATTGC
rJMFF035C17+ TCGATCCATTCACTA-CTAGGGTTACAGGCCCAGACGTTCAGGAGTGTGGTATTAATTGC
rJMSF047A02+ TCGATCCATTCACTA-CTAGGGTTACAGGCCCAGACGTTCAGGAGTGTGGTATTAATTGC
rJMFF022E19+ TCGATCCATTCACTA-CTAGGGTTACAGGCCCAGACGTTCAGGAGTGTGGTATTAATTGC
rJMFF043N06+ TCGATCCATTCACTA-CTAGGGTTACAGGCCCAGACGTTCAGGAGTGTGGTATTAATTGC
                      ____________________________________________________________
consensus TCGATCCATTCACTA-CTAGGGTTACAGGCCCAGACGTTCAGGAGTGTGGTATTAATTGC
 
. : . : . : . : . : . :
rJMFF045A04+ TAGGTTAACACCACGAATCAACGATGAGAAGCTGGAGGGCTGTCAAATGCCAGTTCAATC
rJMFF037B20+ TAGGTTAACANCANGAATCAACGATGAGAAGCTGGAGGGCTGTCAAATNCCAGTTCAATC
rJMFF012D11+ TAGGTTAACAACACGAATCAACGATGAGAAGCTGGAGGGCTGTCAAATGCCAGTTCAATC
rJMFF017G07+ TAGGTTAACAACACGAATCAACGATGAGAAGCTGGAGGGCTGTCAAATGCCAGTTCAATC
rJMFF035C17+ TAGGTTAACAACACGAATCAACGATGAGAAGCTGGAGGGCTGTCAAATGCCAGTTCAATC
rJMSF047A02+ TAGGTTAACAACACGAATCAACGATGAGAAGCTGGAGGGCTGTCAAATGCCAGTTCAATC
rJMFF022E19+ TAGGTTAACAACACGAATCAACGATGAGAAGCTGGAGGGCTGTCAAATGCCAGTTCAATC
rJMFF043N06+ TAGGTTAACAACACGAATCAACGATGAGAAGCTGGAGGGCTGTCAAATGCCAGTTCAATC
                      ____________________________________________________________
consensus TAGGTTAACAACACGAATCAACGATGAGAAGCTGGAGGGCTGTCAAATGCCAGTTCAATC
 
. : . : . : . : . : . :
rJMFF045A04+ TGGATAAGCCAGAGAGTCACGGAGGTCAGTTCAATTTGCAGGCATTTTTTTCCCCCATCT
rJMFF037B20+ TGGATAAGCCAGAGAGTCACGGAGGTCAGTTCAATTTGCAGGCATTTTTCTCCCCCATAT
rJMFF012D11+ TGGATAAGCCAGAGAGTCACGGAGGTCAGTTCAATTTGCAGGCATTTTTCTCCCCCATCT
rJMFF017G07+ TGGATAAGCCAGAGAGTCACGGAGGTCAGTTCAATTTGCAGGCATTTTTCTCCCCCATCT
rJMFF035C17+ TGGATAAGCCAGAGAGTCACGGAGGTCAGTTCAATTTGCAGGCATTTTTCTCCCCCATCT
rJMSF047A02+ TGGATAAGCCAGAGAGTCACGGAGGTCAGTTCAATTTGCAGGCATTTTTCTCCCCCATCT
rJMFF022E19+ TGGATAAGCCAGAGAGTCACGGAGGTCAGTTCAATTTGCAGGCATTTTTCTCCCCCATCT
rJMFF043N06+ TGGATAAGCCAGAGAGTCACGGAGGTCAGTTCAATTTGCAGGCATTTTTCTCCCCCATCT
                      ____________________________________________________________
consensus TGGATAAGCCAGAGAGTCACGGAGGTCAGTTCAATTTGCAGGCATTTTTCTCCCCCATCT
 
. : . : . : . : . : . :
rJMFF045A04+ GGCTATTTTACCTGTTTTGTTTATGTGAAATTTGGTTGTGAAGAATTAGAAATGTGAAAT
rJMFF037B20+ GGGTNTTCTACNTGTTTT
rJMFF012D11+ GGCTATTCTACCTGTTTTGTTTATGTGAAATTTGGTTGTGAAGAATTAGAAATGTGAAAT
rJMFF017G07+ GGCTATTCTACCTGTTTTGTTTATGTGAAATTTGGTTGTGAAGAATTAGAAATGTGAAAT
rJMFF035C17+ GGCTATTCTACCTGTTTTGTTTATGTGAAATTTGGTTGTGAAGAATTAGAAATGTGAAAT
rJMSF047A02+ GGCTATTCTACCTGTTTTGTTTATGTGAAATTTGGTTGTGAAGAATTAGAAATGTGAAAT
rJMFF022E19+ GGCTATTCTACCTGTTTTGTTTATGTGAAATTTGGTTGTGAAGAATTAGAAATGTGAAAT
rJMFF043N06+ GGCTATTCTACCTGTTTTGTTTATGTGAAATTTGGTTGTGAAGAATTAGAAATGTGAAAT
                      ____________________________________________________________
consensus GGCTATTCTACCTGTTTTGTTTATGTGAAATTTGGTTGTGAAGAATTAGAAATGTGAAAT
 
. : . : . : . : . : . :
rJMFF045A04+ ATTTTTTTGTTTCAATACCAAACAGAATTTCCACTCCCCTGCCCCTTTAGCTTGTATACT
rJMFF012D11+ ATTTTCTTGTTTCAATACCAAACAGAATTTCCACTCCCCTGCCCCTCTAGCTTGTATACT
rJMFF017G07+ ATTTTCTTGTTTCAATACCAAACAGAACTTCCACTCCCCTGCCCCTCTAGCTTGTATACT
rJMFF035C17+ ATTTTCTTGTTTCAATACCAAACAGAACTTCCACTCCCCTGCCCCTCTAGCTTGTATACT
rJMSF047A02+ ATTTTCTTGTTTCAATACCAAACAGAACTTCCACTCCCCTGCCCCTCTAGCTTGTATACT
rJMFF022E19+ ATTTTCTTGTTTCAATACCAAACAGAACTTCCACTCCCCTGCCCCTCTAGCTTGTATACT
rJMFF043N06+ ATTTTCTTGTTTCAATACCAAACAGAACTTCCACTCCCCTGCCCCTCTAGCTTGTATACT
                      ____________________________________________________________
consensus ATTTTCTTGTTTCAATACCAAACAGAACTTCCACTCCCCTGCCCCTCTAGCTTGTATACT
 
. : . : . : . : . : . :
rJMFF045A04+ CAGAAAGAGAGTGTTACATTTACATATTTATTCCATTTATATATAGGGCGGAAATGCTGG
rJMFF012D11+ CAGAAAGAGAGTGTTACATTTACATATTTATTCCATTTATATATAGGGCGGAAATGCTGG
rJMFF017G07+ CAGAAAGAGAGTGTTACATTTACATATTTATTCCATTTATATATAGGGCGGAAATGCTGG
rJMFF035C17+ CAGAAAGAGAGTGTTACATTTACATATTTATTCCATTTATATATAGGGCGGAAATGCTGG
rJMSF047A02+ CAGAAAGAGAGTGTTACATTTACATATTTATTCCATTTATATATAGGGCGGAAATGCTGG
rJMFF022E19+ CAGAAAGAGAGTGTTACATTTACATATTTATTCCATTTATATATAGGGCGGAAATGCTGG
rJMFF043N06+ CAGAAAGAGAGTGTTACATTTACATATTTATTCCATTTATATATAGGGCGGAAATGCTGG
                      ____________________________________________________________
consensus CAGAAAGAGAGTGTTACATTTACATATTTATTCCATTTATATATAGGGCGGAAATGCTGG
 
. : . : . : . : . : . :
rJMFF045A04+ GAGCTTGTATAATGCCCCTATTCATT
rJMFF012D11+ GAGCTTGTATAATGCACCTATTCATTTAATTTAATGGCTTTATGCCTCAGTGTATCAATG
rJMFF017G07+ GAGCTTGTATAATGCACCTATTCATT
rJMFF035C17+ GAGCTTGTATAATGCACCTATTCATTTAATTTAATGGCTTTATGCCTCAGTGTATCAATG
rJMSF047A02+ GAGCTTGTATAATGCACCTATTCATTTAATTTAATGGCTTTATGCCTCAGTGTATCAATG
rJMFF022E19+ GAGCTTGTATAATGCACCTATTCATTTAATTTAATGGCTTTATGCCTCAGTGTATCAATG
rJMFF043N06+ GAGCTTGTATAATGCACCTATTCATTTAATTTAATGGCTTTATGCCTCAGTGTATCAATG
                      ____________________________________________________________
consensus GAGCTTGTATAATGCACCTATTCATTTAATTTAATGGCTTTATGCCTCAGTGTATCAATG
 
. : . : . : . : . : . :
rJMFF012D11+ TATTCATTTACAATCATCCCCTTGAATTCAGTTA
rJMFF035C17+ TATTCATTTACAATCATCCCC-TGAATTCAGTTA
rJMSF047A02+ TATTCATTTACAATCATCCCCTTGAATTCAGTTA
rJMFF022E19+ TATTCATTTACAATCATCCCCTTGAATTCAGTTA
rJMFF043N06+ TATTCATTTACAATATTCCCCTTGAATTCAGTTATGATAATATAAATAGTTGTGTTGATC
                      ____________________________________________________________
consensus TATTCATTTACAATCATCCCCTTGAATTCAGTTATGATAATATAAATAGTTGTGTTGATC