Previous Contig 010358:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004P22Sequence199005361 (6)682010358 (4)gb:BT015339_16421676e-35Arabidopsis thaliana At2g42280 gene, complete cds.>gb:BT015712_1642330 Arabidops
JMFF029E07Sequence419005361 (6)741010358 (4)gb:BT015339_16421677e-35Arabidopsis thaliana At2g42280 gene, complete cds.>gb:BT015712_1642330 Arabidops
JMFF043M23Sequence645005361 (6)511010358 (4)gb:BT015339_16421676e-31Arabidopsis thaliana At2g42280 gene, complete cds.>gb:BT015712_1642330 Arabidops
JMSF029P04Sequence482005361 (6)678010358 (4)gb:BT015339_16421676e-35Arabidopsis thaliana At2g42280 gene, complete cds.>gb:BT015712_1642330 Arabidops

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF029P04+ TTCAATGAAGATCAGACAATGGATGAAAGTTACTTGTCAAGTTT
rJMFF029E07+ GGCTTCAATGAAGATCAGACAATGGATGAAAGTTACTTGTCAAGTTT
                      ____________________________________________________________
consensus GGCTTCAATGAAGATCAGACAATGGATGAAAGTTACTTGTCAAGTTT
 
. : . : . : . : . : . :
rJMFF004P22+ TCTTGGGATGATTTAGATCTCTTGTCTGATGACTTCCTTAAAGTAACAGA
rJMSF029P04+ CCCTATACCTTCTTGGGATGATTTAGATCTCTTGTCTGATGACTTCCTTAAAGTAACAGA
rJMFF029E07+ CCCTATACCTTCTTGGGATGATTTAGATCTCTTGTCTGATGACTTCCTTAAAGTAACAGA
                      ____________________________________________________________
consensus CCCTATACCTTCTTGGGATGATTTAGATCTCTTGTCTGATGACTTCCTTAAAGTAACAGA
 
. : . : . : . : . : . :
rJMFF004P22+ TGAAAAGCCAAGTTTGAAAGCAAAAGCACCAGATTTTAAGAACACAGAAGGTAGTCGAAG
rJMSF029P04+ TGAAAAGCCAAGTTTGAAAGCAAAAGCACCAGATTTTAAGAACACAGAAGGTAGTCGAAG
rJMFF029E07+ TGAAAAGCCAAGTTTGAAAGCAAAAGCACCAGATTTTAAGAACACAGAAGGTAGTCGAAG
                      ____________________________________________________________
consensus TGAAAAGCCAAGTTTGAAAGCAAAAGCACCAGATTTTAAGAACACAGAAGGTAGTCGAAG
 
. : . : . : . : . : . :
rJMFF004P22+ TCGCCCTCCCGGCCGTTTATCTCATCACCTCAGTTTACCCAAAAGCTCCGAGGAGTTATC
rJMSF029P04+ TCGCCCTCCCGGCCGTTTATCTCATCACCTCAGTTTACCCAAAAGCTCCGAGGAGTTATC
rJMFF029E07+ TCGCCCTCCCGGCCGTTTATCTCATCACCTCAGTTTACCCAAAAGCTCCGAGGAGCTATC
                      ____________________________________________________________
consensus TCGCCCTCCCGGCCGTTTATCTCATCACCTCAGTTTACCCAAAAGCTCCGAGGAGTTATC
 
. : . : . : . : . : . :
rJMFF004P22+ GTCCATATTGCAGGATTCTGTGCCTTGCAGGGTCCGGGCAAAGAGAGGTTGCGCTACTCA
rJMSF029P04+ GTCCATATTGCAGGATTCTGTGCCTTGCAGGGTCCGGGCAAAGAGAGGTTGCGCTACTCA
rJMFF029E07+ GTCCATATTGCAGGATTCTGTGCCTTGCAGGGTCCGGGCAAAGAGAGGTTGCGCTACTCA
rJMFF043M23+ GGGTCCGGGCAAAGAGAGGTTGCGCTACTCA
                      ____________________________________________________________
consensus GTCCATATTGCAGGATTCTGTGCCTTGCAGGGTCCGGGCAAAGAGAGGTTGCGCTACTCA
 
. : . : . : . : . : . :
rJMFF004P22+ CCCTCGCAGCATTGCCGAGAGGGTTAGAAGAACTCGAATAAGCGACAGAATGAGGAAGCT
rJMSF029P04+ CCCTCGCAGCATTGCCGAGAGGGTTAGAAGAACTCGAATAAGCGACAGAATGAGGAAGCT
rJMFF029E07+ CCCTCGCAGCATTGCCGAGAGGGTTAGAAGAACTCGAATAAGCGACAGAATGAGGAAGCT
rJMFF043M23+ CCCTCGCAGCATTGCCGAGAGGGTTAGAAGAACTCGAATAAGCGACAGAATGAGGAAGCT
                      ____________________________________________________________
consensus CCCTCGCAGCATTGCCGAGAGGGTTAGAAGAACTCGAATAAGCGACAGAATGAGGAAGCT
 
. : . : . : . : . : . :
rJMFF004P22+ GCAAGAGCTCGTCCCGAACATGGACAAGCAAACAAACACAGCAGATATGTTGGACCTGGC
rJMSF029P04+ GCAAGAGCTCGTCCCGAACATGGACAAGCAAACAAACACAGCAGATATGTTGGACCTGGC
rJMFF029E07+ GCAAGAGCTCGTCCCGAACATGGACAAGCAAACAAACACAGCAGATATGTTGGACCTGGC
rJMFF043M23+ GCAAGAGCTCGTCCCGAACATGGACAAGCAAACAAACACAGCAGATATGTTGGACCTGGC
                      ____________________________________________________________
consensus GCAAGAGCTCGTCCCGAACATGGACAAGCAAACAAACACAGCAGATATGTTGGACCTGGC
 
. : . : . : . : . : . :
rJMFF004P22+ AGTGGATTACATTAAAGATCTAGAGCAGAAAGTGAAGAGGTTAGCTGATAATCGTGCCAA
rJMSF029P04+ AGTGGATTACATTAAAGATCTAGAGCAGAAAGTGAAGAGGTTAGCTGATAATCGTGCCAA
rJMFF029E07+ AGTGGATTACATTAAAGATCTAGAGCAGAAAGTGAAGAGGTTAGCTGATAATCGTGCCAA
rJMFF043M23+ AGTGGATTACATTAAAGATCTAGAGCAGAAAGTGAAGAGGTTAGCTGATAATCGTGCCAA
                      ____________________________________________________________
consensus AGTGGATTACATTAAAGATCTAGAGCAGAAAGTGAAGAGGTTAGCTGATAATCGTGCCAA
 
. : . : . : . : . : . :
rJMFF004P22+ GTGTAGATGCTCGAATAAGTAGTAGGGCAGGGATGTACCGATGAATGTAACGTGGAAAGT
rJMSF029P04+ GTGTAGATGCTCGAATAAGTAGTAGGGCAGGGATGTACCGATGAATGTAACGTGGAAAGT
rJMFF029E07+ GTGTAGATGCTCGAATAAGTAGTAGGGCAGGGATGTACCGATGAATGTAACGTGGAAAGT
rJMFF043M23+ GTGTAGATGCTCGAATAAGTAGTAGGGCAGGGATGTACCGATGAATGTAACGTGGAAAGT
                      ____________________________________________________________
consensus GTGTAGATGCTCGAATAAGTAGTAGGGCAGGGATGTACCGATGAATGTAACGTGGAAAGT
 
. : . : . : . : . : . :
rJMFF004P22+ TGATGAACATTGTGGGATTCCTCCTGGCACTAAATTAATCACAGATCAAAAGAAGAAAAT
rJMSF029P04+ TGATGAACATTGTGGGATTCCTCCTGGCACTAAATTAATCACAGATCAAAAGAAGAAAAT
rJMFF029E07+ TGATGAACATTGTGGGATTCCTCCTGGCACTAAATTAATCACAGATCAAAAGAAGAAAAT
rJMFF043M23+ TGATGAACATTGTGGGATTCCTCCTGGCACTAAATTAATCACAGATCAAAAGAAGAAAAT
                      ____________________________________________________________
consensus TGATGAACATTGTGGGATTCCTCCTGGCACTAAATTAATCACAGATCAAAAGAAGAAAAT
 
. : . : . : . : . : . :
rJMFF004P22+ GGGATGGGAGTGCCACAAAAACAATTTCATTTGATGTAACATATGAAGCGCTGTTGAACA
rJMSF029P04+ GGGATGGGAGTGCCACAAAAACAATTTCATTTGATGTAACATATGAAGCGCTGTTGAACA
rJMFF029E07+ GGGATGGGAGTGCCACAAAAACAATTTCATTTGATGTAACATATGAAGCGCTGTTGAACA
rJMFF043M23+ GGGATGGGAGTGCCACAAAAACAATTTCATTTGATGTAACATATGAAGCGCTGTTGAACA
                      ____________________________________________________________
consensus GGGATGGGAGTGCCACAAAAACAATTTCATTTGATGTAACATATGAAGCGCTGTTGAACA
 
. : . : . : . : . : . :
rJMFF004P22+ TAAAAGCATTAATGTTTGTGTTGGGTGTACCCCTCTTTTTGTCCATAAATAATGAAAAGA
rJMSF029P04+ TAAAAGCATTAATGTTTGTGTTGGGTGTACCCCT
rJMFF029E07+ TAAAAGCATTAATGTTTGTGTTGGGTGTACCCCTCTTTTTGTCCATAAATAATGAAAAGA
rJMFF043M23+ TAAAAGCATTAATGTTTGTGTTGGGTGTACCCCTCTTTTTGTCCATAAATAATGAAAAGA
                      ____________________________________________________________
consensus TAAAAGCATTAATGTTTGTGTTGGGTGTACCCCTCTTTTTGTCCATAAATAATGAAAAGA
 
. : . : . : . : . : . :
rJMFF004P22+ ATTTGGTAGGCTCGAGTGTCCTTTACACGCTA
rJMFF029E07+ ATTTGGTAGGCTCGAGTGTCCTTTACACGCTA
rJMFF043M23+ ATTTGGTAGGCTCGAGTGTCCTTTACACGCTATTTTTTATTAAAACGTTGTTTGCTGCTT
                      ____________________________________________________________
consensus ATTTGGTAGGCTCGAGTGTCCTTTACACGCTATTTTTTATTAAAACGTTGTTTGCTGCTT