Previous Contig 010355:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF004D16Sequence441000182 (7)425010355 (11)
JMFF011N23Sequence579000182 (7)gb:AY086922_15719603e-08Arabidopsis thaliana clone 29551 mRNA, complete sequence.444010355 (11)
JMFF021O10Sequence336010355 (11)
JMFF025L14Sequence127010355 (11)
JMFF028C06Sequence500000182 (7)681010355 (11)gb:AB016874_15129382e-61Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K23L20.>gb:BT003900_16
JMFF032H02Sequence253000182 (7)684010355 (11)gb:AB016874_15129381e-62Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K23L20.>gb:BT003900_16
JMFF043M14Sequence639000182 (7)gb:AY086922_15719602e-08Arabidopsis thaliana clone 29551 mRNA, complete sequence.645010355 (11)
JMFF046I06Sequence515000182 (7)532010355 (11)
JMFF047M05Sequence465000182 (7)437010355 (11)gb:AB024033_15157855e-29Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MBK21.
JMFS085F09Sequence627010355 (11)gb:AB016874_15129385e-61Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K23L20.>gb:BT003900_16
JMFS085F10Sequence618010355 (11)gb:AB016874_15129385e-61Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K23L20.>gb:BT003900_16

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS085F10- AGTTTCAAAATA
JMFS085F09- AGTTTCAAAATA
                      ____________________________________________________________
consensus AGTTTCAAAATA
 
. : . : . : . : . : . :
JMFS085F10- CACAGAGAAGAAGATAACTTGTTGTTTGAACTATTGGTGTTAACTGGTGCACAAGTTGGA
JMFS085F09- CACAGAGAAGAAGATAACTTGTTGTTTGAACTATTGGTGTTAACTGGTGCACAAGTTGGA
rJMFF032H02+ GATAACATGTTGTTTGAACTATTGGTGTTAACTGGTGCACAAGTTGGA
rJMFF028C06+ GATAACATGTTGTTTGAACTATTGGTGTTAANTGGTGCACAAGTTGGA
                      ____________________________________________________________
consensus CACAGAGAAGAAGATAACTTGTTGTTTGAACTATTGGTGTTAACTGGTGCACAAGTTGGA
 
. : . : . : . : . : . :
JMFS085F10- TCAGATTGGACAATTGTCTTGAAGAAAAGGCAAGATTTCAGGGATGCATTTTCAGGGTTT
JMFS085F09- TCAGATTGGACAATTGTCTTGAAGAAAAGGCAAGATTTCAGGGATGCATTTTCAGGGTTT
rJMFF032H02+ TCAGATTGGACAATTGTCTTGAAGAAAAGGCAAGATTTCAGGGATGCATTTTCAGGGTTT
rJMFF028C06+ TCAGATTGGACAATTGTCTTGAAGAAAAGGCAAGATTTCAGGGATGCATTTTCAGGGTTT
                      ____________________________________________________________
consensus TCAGATTGGACAATTGTCTTGAAGAAAAGGCAAGATTTCAGGGATGCATTTTCAGGGTTT
 
. : . : . : . : . : . :
JMFS085F10- GATGCAGAAGCAGTTTCAAAATACACAGAGAAGAAGATAACTTCTGTAAGTGCTGAATAT
JMFS085F09- GATGCAGAAGCAGTTTCAAAATACACAGAGAAGAAGATAACTTCTGTAAGTGCTGAATAT
rJMFF032H02+ GATGCAGAAGCAGTTTCAAAATACACAGAGAAGAAGATAACTTCTGTAAGTGCTGAATAT
rJMFF028C06+ GATGCAGAAGCAGTTTCAAAATACACAGAGAAGAAGATAACTTCTGTAAGTGCTGAATAT
                      ____________________________________________________________
consensus GATGCAGAAGCAGTTTCAAAATACACAGAGAAGAAGATAACTTCTGTAAGTGCTGAATAT
 
. : . : . : . : . : . :
JMFS085F10- GGCATAGAATTGAGCCAAGTGAGAGGAGCTGTTGACAACTCTATCAGAATTCTTGAGGTC
JMFS085F09- GGCATAGAATTGAGCCAAGTGAGAGGAGCTGTTGACAACTCTATCAGAATTCTTGAGGTC
rJMFF032H02+ GGCATAGAATTGAGCCAAGTGAGAGGAGCTGTTGACAACTCTATCAGAATTCTTGAGATC
rJMFF028C06+ GGCATAGAATTGAGCCAAGTGAGAGGAGCTGTTGACAACTCTATCAGAATTCTTGAGGTC
                      ____________________________________________________________
consensus GGCATAGAATTGAGCCAAGTGAGAGGAGCTGTTGACAACTCTATCAGAATTCTTGAGGTC
 
. : . : . : . : . : . :
JMFS085F10- AAGAAGCAATTTGGGTCATTTGATAATTACCTATGGGCATATGTGAACCACAAGCCAATT
JMFS085F09- AAGAAGCAATTTGGGTCATTTGATAATTACCTATGGGCATATGTGAACCACAAGCCAATT
rJMFF032H02+ AAGAAGCAATTTGGGTCATTTGATAATTACCTATGGGCATATGTGAACCACAAGCCAATT
rJMFF028C06+ AAGAAGCAATTTGGGTCATTTGATAATTACCTATGGGCATATGTGAACCACAAGCCAATT
rJMFF047M05+ GATAATTACCTATGGGCATATGTGAACCACAAGCCAATT
                      ____________________________________________________________
consensus AAGAAGCAATTTGGGTCATTTGATAATTACCTATGGGCATATGTGAACCACAAGCCAATT
 
. : . : . : . : . : . :
JMFS085F10- GCCACACAGTACAAGTGGTGCAACAAGATTCCGGTGAAGACCTCAAAATCAGAAGCCATA
JMFS085F09- GCCACACAGTACAAGTGGTGCAACAAGATTCCGGTGAAGACCTCAAAATCAGAAGCCATA
rJMFF032H02+ GCCACACAGTACAAGTGGTGCAACAAGATTCCGGTGAAGACCTCAAAATCAGAAGCCATA
rJMFF028C06+ GCCACACAGTACAAGTGGTGCAACAAGATTCCGGTGAAGACCTCAAAATCAGAAGCCATA
rJMFF047M05+ GCCACACAGTACAAGTGGTGCAACAAGATTCCGGTGAAGACCTCAAAATCAGAAGCCATA
                      ____________________________________________________________
consensus GCCACACAGTACAAGTGGTGCAACAAGATTCCGGTGAAGACCTCAAAATCAGAAGCCATA
 
. : . : . : . : . : . :
JMFS085F10- AGCAAAGACATGGTGAAGAGAGGGTTCCGGTACGTCGGTCCAACCGTCATCCACTCGTTC
JMFS085F09- AGCAAAGACATGGTGAAGAGAGGGTTCCGGTACGTCGGTCCAACCGTCATCCACTCGTTC
rJMFF032H02+ AGCAAAGACATGGTGAAGAGAGGGTTCCGGTACGTCGGTCCAACCGTCATCCACTCGTTC
rJMFF028C06+ AGCAAAGACATGGTGAAGAGAGGGTTCCGGTACGTCGGTCCAACCGTCATCCACTCGTTC
rJMFF047M05+ AGCAAAGACATGGTGAAGAGAGGGTTCCGGTACGTCGGTCCAGCCGTCATCCACTCGTTC
                      ____________________________________________________________
consensus AGCAAAGACATGGTGAAGAGAGGGTTCCGGTACGTCGGTCCAACCGTCATCCACTCGTTC
 
. : . : . : . : . : . :
JMFS085F10- ATGCAGGCCGCCGGCCTTACCAACGACCACCTCACCACCTGCCCGCGACACCACCCGTGC
JMFS085F09- ATGCAGGCCGCCGGCCTTACCAACGACCACCTCACCACCTGCCCGCGACACCACCCGTGC
rJMFF032H02+ ATGCAGGCCGCCGGCCTTACCAACGACCACCTCACCACCTGCCCGCGACACCACCCGTGC
rJMFF028C06+ ATGCAGGCCGCCGGCCTTACCAACGACCACCTCACCACCTGCCCGCGACACCACCCGTGC
rJMFF047M05+ ATGCAGGCCGCCGGCCTTACCAACGACCACCTCACCACCTGCCCGCGACACCACCCGTGC
                      ____________________________________________________________
consensus ATGCAGGCCGCCGGCCTTACCAACGACCACCTCACCACCTGCCCGCGACACCACCCGTGC
 
. : . : . : . : . : . :
JMFS085F10- GCCGAGCTGGCCGCTCCCCAACGTCCCTCCACCACCCCCTCAATCTAAATCAACTGCCTT
JMFS085F09- GCCGAGCTGGCCGCTCCCCAACGTCCCTCCACCACCCCCTCAATCTAAATCAACTGCCTT
rJMFF032H02+ GCCGAGCTGGCCGCTCCCCAACGTCCCTCCACCACCCCCTCAATCTAAATCAACTGCCTT
rJMFF028C06+ GCCGAGCTGGCCGCTCCCCAACGTCCCTCCACCACCCCCTCAATCTAAATCAACTGCCTT
rJMFF047M05+ GCCGAGCTGGCCGCTCCCCAACGTCCCTCCACCACCCCCTCAATCTAAATCAACTGCCTT
                      ____________________________________________________________
consensus GCCGAGCTGGCCGCTCCCCAACGTCCCTCCACCACCCCCTCAATCTAAATCAACTGCCTT
 
. : . : . : . : . : . :
JMFS085F10- CAACAAATCATCGTGACTTATTATCATGATTGACTAATTAACACTAGATAGTTGTACTTT
JMFS085F09- CAACAAATCATCGTGACTTATTATCATGATTGACTAATTAACACTAGATAGTTGTACTTT
rJMFF032H02+ CAACAAATCATCGTGACTTATTATCATGATTGACTAATTAACACTAGATAGTTGTACTTT
rJMFF028C06+ CAACAAATCATCGTGACTTATTATCATGATTGACTAATTAACACTAGATAGTTGTACTTT
rJMFF047M05+ CAACAAATCATCGTGACTTATTATCATGATTGACTAATTAACACTAGATAGTTGTACTTT
                      ____________________________________________________________
consensus CAACAAATCATCGTGACTTATTATCATGATTGACTAATTAACACTAGATAGTTGTACTTT
 
. : . : . : . : . : . :
JMFS085F10- TTGGTT
JMFS085F09- TTGGTTTGATATGAT
rJMFF032H02+ TTGGTTTGATATGATGCAAGTAGTTTGAAGTTGTAATATGATTTGGGAGGTGTGACATGC
rJMFF028C06+ TTGGTTTGATATGATGCAAGTAGTTTGAAGTTGTAATATGATTTGGGAGGTGTGACATG-
rJMFF047M05+ TTGGTTTGATATGATGCAAGTAGTTTGAAGTTGTAATATGATTTGGGAGGTGTGACATG-
rJMFF046I06+ GATGCAAGTAGTTTGAAGTTGTAATATGATTTGGGAGGTGTGACATG-
                      ____________________________________________________________
consensus TTGGTTTGATATGATGCAAGTAGTTTGAAGTTGTAATATGATTTGGGAGGTGTGACATG-
 
. : . : . : . : . : . :
rJMFF032H02+ CATATTATATTCTTAATTAAGA
rJMFF028C06+ CATATTATATTCTTAATTAAGA
rJMFF047M05+ CATATTATATTCTTAATTAAGATAAAGATGTAATTAAGT
rJMFF046I06+ CATATTATATTCTTAATTAAGATAAAGATGTAATTAAGTAAAATAAGAGTTGGGGGGGGG
rJMFF004D16+ GGGGGGG
rJMFF011N23+ GGGGGGG
rJMFF043M14+ ATTAAGATAAAGATGTAATTAAGTAAAATAAGAGTTGGGGGGGGG
                      ____________________________________________________________
consensus CATATTATATTCTTAATTAAGATAAAGATGTAATTAAGTAAAATAAGAGTTGGGGGGGGG
 
. : . : . : . : . : . :
rJMFF046I06+ GGGGGGGGGACAGGTTGCATGTGCAATGGGGGCAGGGGAATGGTTAAAGGCATGTGTTTG
rJMFF004D16+ GGGGGGGGGACAGGTTGCATGTGCAATGGGGGCAGGGGAATGGTTAAAGGCATGTGTTTG
rJMFF011N23+ GGGGGGGGGACAGGTTGCATGTGCAATGGGGGCAGGGGAATGGTTAAAGGCATGTGTTTG
rJMFF043M14+ GGGGGGGGGACAGGTTGCATGTGCAATGGGGGCAGGGGAATGGTTAAAGGCATGTGTTTG
                      ____________________________________________________________
consensus GGGGGGGGGACAGGTTGCATGTGCAATGGGGGCAGGGGAATGGTTAAAGGCATGTGTTTG
 
. : . : . : . : . : . :
rJMFF046I06+ GTGCATATGCCTTTCATTTATTCTCTTGACTGACCCCCACAAACCTCTATTATTAATTTC
rJMFF025L14+ CCCACAAACNTNTANTATTAATTTC
rJMFF004D16+ GTGCATATGCCTTTCATTTATTCTCTTGACTGACCCCCACAAACCTCTATTATTAATTTC
rJMFF011N23+ GTGCATATGCCTTTCATTTATTCTCTTGACTGACCCCCACAAACCTCTATTATTAATTTC
rJMFF021O10+ TATTATTAATTTC
rJMFF043M14+ GTGCATATGCCTTTCATTTATTCTCTTGACTGACCCCCACAAACCTCTATTATTAATTTC
                      ____________________________________________________________
consensus GTGCATATGCCTTTCATTTATTCTCTTGACTGACCCCCACAAACCTCTATTATTAATTTC
 
. : . : . : . : . : . :
rJMFF046I06+ TTGCCCCCCCTGCATGTACTTTGAAGAGAAGAGAAGATAAACATTCTCATCATCAGAGCA
rJMFF025L14+ NTGCCCCCCATGCATGTNCTTTGAAGAGAAGAGAAGATAANCATTCTCATCATCAGANCA
rJMFF004D16+ TTGCCCCCCCTGCATGTACTTTGAAGAGAAGAGAAGATAAACATTCTCATCATCAGAGCA
rJMFF011N23+ TTGCCCCCCCTGCATGTACTTTGAAGAGAAGAGAAGATAAACATTCTCATCATCAGAGCA
rJMFF021O10+ TTGCCCCCCCTGCATGTACTTTGAAGAGAAGAGAAGATAAACATTCTCATCATCAGAGCA
rJMFF043M14+ TTGCCCCCCCTGCATGTACTTTGAAGAGAAGAGAAGATAAACATTCTCATCATCAGAGCA
                      ____________________________________________________________
consensus TTGCCCCCCCTGCATGTACTTTGAAGAGAAGAGAAGATAAACATTCTCATCATCAGAGCA
 
. : . : . : . : . : . :
rJMFF046I06+ GAGAAAAGGAGGCTCTTTTGGGACCCACTCCTTCATTTCCTTAAATTATTTTAGGAAAAA
rJMFF025L14+ GAGANAAGGAGGCTNTTNTGGGACCCACTCNTTCATTTCC
rJMFF004D16+ GAGAAAAGGAGGCTCTTTTGGGACCCACTCCTTCATTTCCTTAAATTATTTTAGGAAAAA
rJMFF011N23+ GAGAAAAGGAGGCTCTTTTGGGACCCACTCCTTCATTTCCTTAAATTATTTTAGGAAAAA
rJMFF021O10+ GAGAAAAGGAGGCTCTTTTGGGNCCCACTCCTTCATTTCCTTAAATTATTTTAGGAAAAA
rJMFF043M14+ GAGAAAAGGAGGCTCTTTTGGGACCCACTCCTTCATTTCCTTAAATTATTTTAGGAAAAA
                      ____________________________________________________________
consensus GAGAAAAGGAGGCTCTTTTGGGACCCACTCCTTCATTTCCTTAAATTATTTTAGGAAAAA
 
. : . : . : . : . : . :
rJMFF046I06+ AATTGAGGAAAATAATAATATAAAAAGACATGTATAGAGATGGAGTGGTTGTGGTTGTGG
rJMFF004D16+ AATTGAGGAAAATAATAATATAAAAAGACATGTATAGAGATGGAGTGGTTGTGGTTGTGG
rJMFF011N23+ AATTGAGGAAAATAATAATATAAAAAGACATGTATAGAGATGGAGTGGTTGTGGTTGTGG
rJMFF021O10+ AATTGAGGAAAATAATAATATAAAAAGACATGTATAGAGATGGAGTGGTTGTGGTTGTGG
rJMFF043M14+ AATTGAGGAAAATAATAATATAAAAAGACATGTATAGAGATGGAGTGGTTGTGGTTGTGG
                      ____________________________________________________________
consensus AATTGAGGAAAATAATAATATAAAAAGACATGTATAGAGATGGAGTGGTTGTGGTTGTGG
 
. : . : . : . : . : . :
rJMFF046I06+ TGTTGTTGCTCATCCATCCATCTTGCTGATCTCTTCTAACTTTTTACCAGCTTATTAGGG
rJMFF004D16+ TGTTGTTGCTCATCCATCCATCTTGCTGATCTCTTCTAACTTTTTACCAGCTTATTAGGG
rJMFF011N23+ TGTTGTTGCTCATCCATCCATCTTGCTGATCTCTTCTAACTTTTTACCAGCTTATTAGGG
rJMFF021O10+ TGTTGTTGCTCATCCATCCATCTTGNTGATCTCTTCTAACTTTTTACCAGCTTATTAGGG
rJMFF043M14+ TGTTGTTGCTCATCCATCCATCTTGCTGATCTCTTCTAACTTTTTACCAGCTTATTAGGG
                      ____________________________________________________________
consensus TGTTGTTGCTCATCCATCCATCTTGCTGATCTCTTCTAACTTTTTACCAGCTTATTAGGG
 
. : . : . : . : . : . :
rJMFF046I06+ TCAGAGTTATGGGCAAACACAAAAGTTTGTGTTGGTGGAATAATATCATGTACCACATTA
rJMFF004D16+ TCAGAGTTATGGGCAAACACAAAAGTTTGTGTTGGTGGAATAATATCATGTACCACA
rJMFF011N23+ TCAGAGTTATGGGCAAACACAAAAGTTTGTGTTGGTGGAATAATATCATGTACCACATTA
rJMFF021O10+ TCAGAGTTATGGGCAAACACAAAAGTNNGTNTTGGTGGAATAATATCATGTACCACATTA
rJMFF043M14+ TCAGAGTTATGGGCAAACACAAAAGTTTGTGTTGGTGGAATAATATCATGTACCACATTA
                      ____________________________________________________________
consensus TCAGAGTTATGGGCAAACACAAAAGTTTGTGTTGGTGGAATAATATCATGTACCACATTA
 
. : . : . : . : . : . :
rJMFF046I06+ TCT
rJMFF011N23+ TCTTTTGTTTT
rJMFF021O10+ TCTTTTGTTTTNGTGTTTTTTC
rJMFF043M14+ TCTTTTGTTTTTGTGTTTTTTCTAGTGTGAATTTTGGTGTGTTTTTGGATCATATTTGAT
                      ____________________________________________________________
consensus TCTTTTGTTTTTGTGTTTTTTCTAGTGTGAATTTTGGTGTGTTTTTGGATCATATTTGAT
 
. : . : . : . : . : . :
rJMFF043M14+ ATTTCCCATCTTCTTTTTTTTGGTTGGGGATTGTAATGTTTTGGATGATGTTCTATATAA
                      ____________________________________________________________
consensus ATTTCCCATCTTCTTTTTTTTGGTTGGGGATTGTAATGTTTTGGATGATGTTCTATATAA
 
. : . : . : . : . : . :
rJMFF043M14+ ATAAGTGGTTTGTTTTGTTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus ATAAGTGGTTTGTTTTGTTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG