Previous Contig 010354:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF019D03Sequence553001864 (2)gb:AY372938_16033505e-40Mesembryanthemum crystallinum putative calcium-dependent protein kinase CPK1 ada783010354 (3)gb:AY372938_16033501e-67Mesembryanthemum crystallinum putative calcium-dependent protein kinase CPK1 ada
JMFF043M11Sequence631001864 (2)gb:AY372938_16033507e-50Mesembryanthemum crystallinum putative calcium-dependent protein kinase CPK1 ada640010354 (3)gb:AB022211_15149766e-38Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K1L20.>gb:AY127030_158
JMFN038M20Sequence433010354 (3)pir|H84558|H845587e-13hypothetical protein At2g17990 [imported] - Arabidopsis thaliana>gb:AC006201_153

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF019D03+ TGTGAA
                      ____________________________________________________________
consensus TGTGAA
 
. : . : . : . : . : . :
rJMFF019D03+ GGTGACGATAGGAGAGGAAGAGATTNGAAAGAAGGCACTCCAAATCGAAAACATGTCTGT
                      ____________________________________________________________
consensus GGTGACGATAGGAGAGGAAGAGATTNGAAAGAAGGCACTCCAAATCGAAAACATGTCTGT
 
. : . : . : . : . : . :
rJMFF019D03+ AAAATTAGAAGAGATGGAAAGGTTTGCACTGGGCACGAATTGTATCATAAACGAGATGCG
                      ____________________________________________________________
consensus AAAATTAGAAGAGATGGAAAGGTTTGCACTGGGCACGAATTGTATCATAAACGAGATGCG
 
. : . : . : . : . : . :
rJMFF019D03+ CCAGAGAGTTGAGGATCTAGTTGAAGAAACTTCTAGACAGAGACAAAGAGCCTCGGAAAA
                      ____________________________________________________________
consensus CCAGAGAGTTGAGGATCTAGTTGAAGAAACTTCTAGACAGAGACAAAGAGCCTCGGAAAA
 
. : . : . : . : . : . :
rJMFF019D03+ TGATGAGGAGCTTTGTCGCGTCAAGCAAGACTTTGAATCTCTCAAATCCTATGTTAGTAG
rJMFF043M11+ AAGCAAGACTTTGAATCTCTCAAATCCTATGTTAGTAG
                      ____________________________________________________________
consensus TGATGAGGAGCTTTGTCGCGTCAAGCAAGACTTTGAATCTCTCAAATCCTATGTTAGTAG
 
. : . : . : . : . : . :
rJMFF019D03+ TCTCATTAGCGTGAGAGAAACTCTCCTTTCATCTGAAAAGCAGTTCCAGACAATCGAAAG
rJMFF043M11+ TCTCATTAGCGTGAGAGAAACTCTCCTTTCATCTGAAAAGCAGTTCCAGACAATCGAAAG
                      ____________________________________________________________
consensus TCTCATTAGCGTGAGAGAAACTCTCCTTTCATCTGAAAAGCAGTTCCAGACAATCGAAAG
 
. : . : . : . : . : . :
rJMFF019D03+ GCTCTTTGAACGGCTGGTCGCGAAAACAACTCAGTTGGAGAGCGAGAAGGCACAGAAAGA
JMFN038M20- AAAGA
rJMFF043M11+ GCTCTTTGAACGGCTGGTCGCGAAAACAACTCAGTTGGAGAGCGAGAAGGCACAGAAAGA
                      ____________________________________________________________
consensus GCTCTTTGAACGGCTGGTCGCGAAAACAACTCAGTTGGAGAGCGAGAAGGCACAGAAAGA
 
. : . : . : . : . : . :
rJMFF019D03+ GGCTGAAGTCCAGAAACTCATGGAAGAGAACGTGAAGTTGACTGCGTTACTGGACAAGAA
JMFN038M20- GGCTGAAGTCCAGAAACTCATGGAAGAGAACGTGAAGTTGACTGCGTTACTGGACAAGAA
rJMFF043M11+ GGCTGAAGTCCAGAAACTCATGGAAGAGAACGTGAAGTTGACTGCGTTACTGGACAAGAA
                      ____________________________________________________________
consensus GGCTGAAGTCCAGAAACTCATGGAAGAGAACGTGAAGTTGACTGCGTTACTGGACAAGAA
 
. : . : . : . : . : . :
rJMFF019D03+ AGAGGCCCAACTCCTGGCCATGAATCAGCAATGCAAGCTCATGGCACTTAGTGCTTTAAA
JMFN038M20- AGAGGCCCAACTCCTGGCCATGAATCAGCAATGCAAGCTCATGGCACTTAGTGCTTTAAA
rJMFF043M11+ AGAGGCCCAACTCCTGGCCATGAATCAGCAATGCAAGCTCATGGCACTTAGTGCTTTAAA
                      ____________________________________________________________
consensus AGAGGCCCAACTCCTGGCCATGAATCAGCAATGCAAGCTCATGGCACTTAGTGCTTTAAA
 
. : . : . : . : . : . :
rJMFF019D03+ TGGCTAGTCTGCCACACTTACACAGGCATTTGTGCCCCCGCTTTTATCACATTCAACCCA
JMFN038M20- TGGCTAGTCTGCCACACTTACACAGGCATTTGTGCCCCCGCTTTTATCACATTCAACCCA
rJMFF043M11+ TGGCTAGTCTGCCACACTTACACAGGCATTTGTGCCCCCGCTTTTATCACATTCAACCCA
                      ____________________________________________________________
consensus TGGCTAGTCTGCCACACTTACACAGGCATTTGTGCCCCCGCTTTTATCACATTCAACCCA
 
. : . : . : . : . : . :
rJMFF019D03+ CCTGTTGGCCTTCCAGCAGATTTAGGTGAGTGGAGCTGTAGAATTCTGTAAAGGTTCCTT
JMFN038M20- CCTGTTGGCCTTCCAGCAGATTTAGGTGAGTGGAGCTGTAGAATTCTGTAAAGGTTCCTT
rJMFF043M11+ CCTGTTGGCCTTCCAGCAGATTTAGGTGAGTGGAGCTGTAGAATTCTGTAAAGGTTCCTT
                      ____________________________________________________________
consensus CCTGTTGGCCTTCCAGCAGATTTAGGTGAGTGGAGCTGTAGAATTCTGTAAAGGTTCCTT
 
. : . : . : . : . : . :
rJMFF019D03+ CTTTTTTTCTCGTGGTTTTAATGGGTGAAACCCAAATGCGTAGTCGTTTTATGTTGGTTG
JMFN038M20- CTTTTTTTCTCGTGGTTTTAATGGGTGAAACCCAAATGCGTAGTCGTTTTATGTTGGTTG
rJMFF043M11+ CTTTTTTTCTCGTGGTTTTAATGGGTGAAACCCAAATGCGTAGTCGTTTTATGTTGGTTG
                      ____________________________________________________________
consensus CTTTTTTTCTCGTGGTTTTAATGGGTGAAACCCAAATGCGTAGTCGTTTTATGTTGGTTG
 
. : . : . : . : . : . :
rJMFF019D03+ GCTGATTGGGCAATTTGCCAAAGGAAATTAAAACACCTTTAGATCTGATACAGAACTTTG
JMFN038M20- GCTGATTGGGCAATTTGCCAAAGGAAATTAAAACACCTTTAGATCTGATACAGAACTTTG
rJMFF043M11+ GCTGATTGGGCAATTTGCCAAAGGAAATTAAAACACCTTTAGATCTGATACAGAACTTTG
                      ____________________________________________________________
consensus GCTGATTGGGCAATTTGCCAAAGGAAATTAAAACACCTTTAGATCTGATACAGAACTTTG
 
. : . : . : . : . : . :
rJMFF019D03+ TTGCATCCTGTGTGATGCCTGCCTGTGTGACAATGTTCAACAAAA
JMFN038M20- TTGCATCCTGTGTGATGCCTGCCTGTGTGACAATGTTCAACAAAAAGCGGCTTTTCGCCT
rJMFF043M11+ TTGCATCCTGTGTGATGCCTGCCTGTGTGACAATGTTCAACAAAAAGCGGCTTTTCGCCT
                      ____________________________________________________________
consensus TTGCATCCTGTGTGATGCCTGCCTGTGTGACAATGTTCAACAAAAAGCGGCTTTTCGCCT
 
. : . : . : . : . : . :
JMFN038M20- TGTAGT
rJMFF043M11+ TGTAGTATAATTGTTCXXXXXXXXXXXXXXXXXXXCTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TGTAGTATAATTGTTCNNNNNNNNNNNNNNNNNNNCTCTCCAGGGTGATCCGCCATAAGG