Previous Contig 010337:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043K16Sequence655010337 (2)gb:AY095998_15758728e-33Glycine max DnaJ-like protein mRNA, complete cds.607010337 (2)gb:AY095998_15758727e-33Glycine max DnaJ-like protein mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043K16- ACAACACAAACCCTGCTTCCTCAGTACTGCATGCTTCTTGCTGAAATTTTCTGGGAATT
rJMFF043K16+ GGGAATN
                      ____________________________________________________________
consensus ACAACACAAACCCTGCTTCCTCAGTACTGCATGCTTCTTGCTGAAATTTTCTGGGAATT
 
. : . : . : . : . : . :
JMFF043K16- GTAGTAATAATACATGGAGTTAGTGCGTTCCAACGGAGAATCTTGTTATTATTCTGTGCT
rJMFF043K16+ GTAGTAATAATACATGGAGTTAGTGCGTTCCAACGGAGAATCTTGTTATTATTCTGTGCT
                      ____________________________________________________________
consensus GTAGTAATAATACATGGAGTTAGTGCGTTCCAACGGAGAATCTTGTTATTATTCTGTGCT
 
. : . : . : . : . : . :
JMFF043K16- TGGAATCTGTAAACAAGCTTCAGATGCTCAAATCCGAGGGGCTTACAGGAAACTTGCTCT
rJMFF043K16+ TGGAATCTGTAAACAAGCTTCAGATGCTCAAATCCGAGGGGCTTACAGGAAACTTGCTCT
                      ____________________________________________________________
consensus TGGAATCTGTAAACAAGCTTCAGATGCTCAAATCCGAGGGGCTTACAGGAAACTTGCTCT
 
. : . : . : . : . : . :
JMFF043K16- GAAATGGCACCCAGATAGATGTGTGAAAGACCCTGCAATTGTTGGACAAGCAAAACATAA
rJMFF043K16+ GAAATGGCACCCAGATAGATGTGTGAAAGACCCTGCAATTGTTGGACAAGCAAAACATAA
                      ____________________________________________________________
consensus GAAATGGCACCCAGATAGATGTGTGAAAGACCCTGCAATTGTTGGACAAGCAAAACATAA
 
. : . : . : . : . : . :
JMFF043K16- ATTTCTGCAAATTCAAGAAGCTTATTCTGTTCTGTCTGACAAAGGGAAGAGATCAGTCTA
rJMFF043K16+ ATTTCTGCAAATTCAAGAAGCTTATTCTGTTCTGTCTGACAAAGGGAAGAGATCAGTCTA
                      ____________________________________________________________
consensus ATTTCTGCAAATTCAAGAAGCTTATTCTGTTCTGTCTGACAAAGGGAAGAGATCAGTCTA
 
. : . : . : . : . : . :
JMFF043K16- TGATGCTGGGTTACTTGACCTGTTGGCAGATAACAGTGATGATAAAGAATTTTGTGGGTT
rJMFF043K16+ TGATGCTGGGTTACTTGACCTGTTGGCAGATAACAGTGATGATAAAGAATTTTGTGGGTT
                      ____________________________________________________________
consensus TGATGCTGGGTTACTTGACCTGTTGGCAGATAACAGTGATGATAAAGAATTTTGTGGGTT
 
. : . : . : . : . : . :
JMFF043K16- CATGCAAGAAATGGTGGCCATGATGGAAAAGGAGAAGTCTCAGGCTGCAAGTAGTTTGGA
rJMFF043K16+ CATGCAAGAAATGGTGGCCATGATGGAAAAGGAGAAGTCTCAGGCTGCAAGTAGTTTGGA
                      ____________________________________________________________
consensus CATGCAAGAAATGGTGGCCATGATGGAAAAGGAGAAGTCTCAGGCTGCAAGTAGTTTGGA
 
. : . : . : . : . : . :
JMFF043K16- GGATCTACAGAACATGTTGCAGGAGATGATGGAAGGGGCTGAAAGATTCAATCAAGAAAG
rJMFF043K16+ GGATCTACAGAACATGTTGCAGGAGATGATGGAAGGGGCTGAAAGATTCAATCAAGAAAG
                      ____________________________________________________________
consensus GGATCTACAGAACATGTTGCAGGAGATGATGGAAGGGGCTGAAAGATTCAATCAAGAAAG
 
. : . : . : . : . : . :
JMFF043K16- CCAGGAAACAGCAGAAAGAACACATTTTATACTGTCATGATGCTTCAATTCATCTGAGAT
rJMFF043K16+ CCAGGAAACAGCAGAAAGAACACATTTTATACTGTCATGATGCTTCAATTCATCTGAGAT
                      ____________________________________________________________
consensus CCAGGAAACAGCAGAAAGAACACATTTTATACTGTCATGATGCTTCAATTCATCTGAGAT
 
. : . : . : . : . : . :
JMFF043K16- TCCAGTTGGATTTTTATGCAGTTTTTGCCTATAAATATTGCATAATTGTAATAATATATA
rJMFF043K16+ TCCAGTTGGATTTTTATGCAGTTTTTGCCTATAAATATTGCATAATTGTAATAATATATA
                      ____________________________________________________________
consensus TCCAGTTGGATTTTTATGCAGTTTTTGCCTATAAATATTGCATAATTGTAATAATATATA
 
. : . : . : . : . : . :
JMFF043K16- ATATGGCAGTATTCACTAAAACTGAGTGTATAGATTCTCACAAGATGGCAGTTTTA
rJMFF043K16+ ATATGGCAGTATTCACTAAAACTGAGTGTATAGATTCTCACAAGATGGCAGTTTTATTGC
                      ____________________________________________________________
consensus ATATGGCAGTATTCACTAAAACTGAGTGTATAGATTCTCACAAGATGGCAGTTTTATTGC