Previous Contig 010324:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF031A20Sequence582001852 (7)pir|T45627|T456271e-50replication factor A-like protein - Arabidopsis thaliana>gb:ATF13G24_1548452 Ara736010324 (7)gb:AB111916_15271501e-88Oryza sativa (japonica cultivar-group) OsRPA70b mRNA for replication protein A 7
JMFF033K02Sequence580001852 (7)pir|T45627|T456276e-50replication factor A-like protein - Arabidopsis thaliana>gb:ATF13G24_1548452 Ara783010324 (7)gb:AB111916_15271503e-98Oryza sativa (japonica cultivar-group) OsRPA70b mRNA for replication protein A 7
JMFF043I21Sequence644001852 (7)pir|T45627|T456274e-56replication factor A-like protein - Arabidopsis thaliana>gb:ATF13G24_1548452 Ara533010324 (7)gb:AB111916_15271503e-48Oryza sativa (japonica cultivar-group) OsRPA70b mRNA for replication protein A 7
JMFF043J01Sequence632001852 (7)pir|T45627|T456278e-57replication factor A-like protein - Arabidopsis thaliana>gb:ATF13G24_1548452 Ara603010324 (7)gb:AB111916_15271502e-75Oryza sativa (japonica cultivar-group) OsRPA70b mRNA for replication protein A 7
JMFF044A15Sequence629001852 (7)pir|T45627|T456271e-53replication factor A-like protein - Arabidopsis thaliana>gb:ATF13G24_1548452 Ara533010324 (7)gb:AB111916_15271503e-48Oryza sativa (japonica cultivar-group) OsRPA70b mRNA for replication protein A 7
JMSF020A13Sequence676001852 (7)pir|T45627|T456274e-66replication factor A-like protein - Arabidopsis thaliana>gb:ATF13G24_1548452 Ara761010324 (7)gb:AB111916_15271502e-93Oryza sativa (japonica cultivar-group) OsRPA70b mRNA for replication protein A 7
JMSF041F22Sequence788001852 (7)pir|T45627|T456275e-85replication factor A-like protein - Arabidopsis thaliana>gb:ATF13G24_1548452 Ara662010324 (7)gb:AB111916_15271502e-78Oryza sativa (japonica cultivar-group) OsRPA70b mRNA for replication protein A 7

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF020A13+ CCAGTAGTTGCAAT
rJMFF033K02+ CCAGTAGTTGCAAT
                      ____________________________________________________________
consensus CCAGTAGTTGCAAT
 
. : . : . : . : . : . :
rJMSF020A13+ CAGATCAGTTAAAGTTGGAGATTTCCCAAGGTTTATCTTTATCTGCAATTACTAGAAGTA
rJMFF033K02+ CAGATCAGTTAAAGTTGGAGATTT-CCAAGGTTTATCTTTATCTGCAATTACTAGAAGTA
rJMFF031A20+ TACTAGAAGTA
                      ____________________________________________________________
consensus CAGATCAGTTAAAGTTGGAGATTTCCCAAGGTTTATCTTTATCTGCAATTACTAGAAGTA
 
. : . : . : . : . : . :
rJMSF020A13+ CTGTACTGGTGAACCCGGATATGCCTGAAGCCAAGAAATTGAGATCTTGGTATGATTGTG
rJMFF033K02+ CTGTACTGGTGAACCCGGATATGCCTGAAGCCAAGAAATTGAGATCTTGGTATGATTGTG
rJMSF041F22+ TATGATTGTG
rJMFF031A20+ CTGTACTGGTGANCCCGGATATGCCTGAAGCCAAGAAATTGAGATCTTGGTATGATTGTG
                      ____________________________________________________________
consensus CTGTACTGGTGAACCCGGATATGCCTGAAGCCAAGAAATTGAGATCTTGGTATGATTGTG
 
. : . : . : . : . : . :
rJMSF020A13+ AAGGG-AAAGAAACCTCATTGACTTCGGTT-GGCTCTGGTTTGAGCTCCTCTGCCAAAGG
rJMFF033K02+ AAGGG-AAAGAAACCTCATTGACTTCGGTT-GGCTCTGGTTTGAGCTCCTCTGCCAAAGG
rJMSF041F22+ AAGGGNAAAGAAACCTCATTGACTTCGGTTNGGCTCTGGTTTGAGCTCCTCTGCCAAAGG
rJMFF031A20+ AAGGG-AAAGAAACCTCATTGACTTCGGTT-GGCTCTGGTTTGAGCTCCTCTGCCAAAGG
                      ____________________________________________________________
consensus AAGGG-AAAGAAACCTCATTGACTTCGGTT-GGCTCTGGTTTGAGCTCCTCTGCCAAAGG
 
. : . : . : . : . : . :
rJMSF020A13+ CGTATTGTGGTCCATGTACTCGGATAGAGTATCCCTACTTCATATAACCAGTAACCCAAA
rJMFF033K02+ CGTATTGTGGTCCATGTACTCGGATAGAGTATCCCTACTTCATATAACCAGTAACCCAAA
rJMSF041F22+ CGTATTGTGGTCCATGTACTCGGATAGAGTATCCCTACTTCATATAACCAGTAACCCAAA
rJMFF031A20+ CGTATTGTGGTCCATGTACTCGGATAGAGTATCCCTACTTCATATAACCAGTAACCCAAA
rJMFF043J01+ GATAGAGTATCCCTACTTCATATAACCAGTAACCCAAA
                      ____________________________________________________________
consensus CGTATTGTGGTCCATGTACTCGGATAGAGTATCCCTACTTCATATAACCAGTAACCCAAA
 
. : . : . : . : . : . :
rJMSF020A13+ CCTGGGTGAGGACAAGCCTGTGTTTTTCAGTATAAAGGCAAATATTAGCTTCATTAAACC
rJMFF033K02+ CCTGGGTGAGGACAAGCCTGTGTTTTTCAGTATAAAGGCAAATATTAGCTTCATTAAACC
rJMSF041F22+ CCTGGGTGAGGACAAGCCTGTGTTTTTCAGTATAAAGGCAAATATTAGCTTCATTAAACC
rJMFF031A20+ CCTGGGTGAGGACAAGCCTGTGTTTTTCAGTATAAAGGCAAATATTAGCTTCATTAAACC
rJMFF043J01+ CCTGGGTGAGGACAAGCCTGTGTTNTTCAGTATAAAGGCAAATATTAGCTTCATTAAACC
                      ____________________________________________________________
consensus CCTGGGTGAGGACAAGCCTGTGTTTTTCAGTATAAAGGCAAATATTAGCTTCATTAAACC
 
. : . : . : . : . : . :
rJMSF020A13+ TGAACAAGCGATGTGGTATAGAGCGTGTAAAACGTGTAACAAGAAAGTGACTGAGGCCAT
rJMFF033K02+ TGAACAAGCGATGTGGTATAGAGCGTGTAAAACGTGTAACAAGAAAGTGACTGAGGCCAT
rJMSF041F22+ TGAACAAGCGATGTGGTATAGAGCGTGTAAAACGTGTAACAAGAAAGTGACTGAGGCCAT
rJMFF031A20+ TGAACAAGCGATGTGGTATAGAGCGTGTAAAACGTGTAACAAGAAAGTGACTGAGGCCAT
rJMFF043J01+ TGAACAAGCGATGTGGTATAGAGCGTGTAAAACGTGTAACAAGAAAGTGACTGAGGCCAT
                      ____________________________________________________________
consensus TGAACAAGCGATGTGGTATAGAGCGTGTAAAACGTGTAACAAGAAAGTGACTGAGGCCAT
 
. : . : . : . : . : . :
rJMSF020A13+ TGGATCTGGGTACTGGTGTGAAGGTTGCCAGAAGAATGACACAGATTGTAGCTTGAGATA
rJMFF033K02+ TGGATCTGGGTACTGGTGTGAAGGTTGCCAGAAGAATGACACAGATTGTAGCTTGAGATA
rJMSF041F22+ TGGATCTGGGTACTGGTGTGAAGGTTGCCAGAAGAATGACACAGATTGTAGCTTGAGATA
rJMFF031A20+ TGGATCTGGGTACTGGTGTGAAGGTTGCCAGAAGAATGACACAGATTGTAGCTTGAGATA
rJMFF043J01+ TGGATCTGGGTACTGGTGTGAAGGTTGCCAGAAGAATGACACAGATTGTAGCTTGAGATA
rJMFF044A15+ GGGTACTGGTGTGAAGGTTGCCAGAAGAATGACACAGATTGTAGCTTGAGATA
rJMFF043I21+ GGGTACTGGTGTGAAGGTTGCCAGAAGAATGACACAGATTGTAGCTTGAGATA
                      ____________________________________________________________
consensus TGGATCTGGGTACTGGTGTGAAGGTTGCCAGAAGAATGACACAGATTGTAGCTTGAGATA
 
. : . : . : . : . : . :
rJMSF020A13+ TATAGTTGCCATGAGGGTGTCTGATACAAGTGGCGAGGCTTGGCTCTCTGTCTTCAATGA
rJMFF033K02+ TATAGTTGCCATGAGGGTGTCTGATACAAGTGGCGAGGCTTGGCTCTCTGTCTTCAATGA
rJMSF041F22+ TATAGTTGCCATGAGGGTGTCTGATACAAGTGGCGAGGCTTGGCTCTCTGTCTTCAATGA
rJMFF031A20+ TATAGTTGCCATGAGGGTGTCTGATACAAGTGGCGAGGCTTGGCTCTCTGTCTTCAATGA
rJMFF043J01+ TATAGTTGCCATGAGGGTGTCTGATACAAGTGGCGAGGCTTGGCTCTCTGTCTTCAATGA
rJMFF044A15+ TATAGTTGCCATGAGGGTGTCTGATACAAGTGGCGAGGCTTGGCTCTCTGTCTTCAATGA
rJMFF043I21+ TATAGTTGCCATGAGGGTGTCTGATACAAGTGGCGAGGCTTGGCTCTCTGTCTTCAATGA
                      ____________________________________________________________
consensus TATAGTTGCCATGAGGGTGTCTGATACAAGTGGCGAGGCTTGGCTCTCTGTCTTCAATGA
 
. : . : . : . : . : . :
rJMSF020A13+ ACAAGCAGAAAAAATAATTGGATGCTCTGCAGATGAGCTTGACAGGCTGAGATCTCAGGA
rJMFF033K02+ ACAAGCAGAAAAAATAATTGGATGCTCTGCAGATGAGCTTGACAGGCTGAGATCTCAGGA
rJMSF041F22+ ACAAGCAGAAAAAATAATTGGATGCTCTGCAGATGAGCTTGACAGGCTGAGATCTCAGGA
rJMFF031A20+ ACAAGCAGAAAAAATAATTGGATGCTCTGCAGATGAGCTTGACAGGCTGAGATCTCAGGA
rJMFF043J01+ ACAAGCAGAAAAAATAATTGGATGCTCTGCAGATGAGCTTGACAGGCTGAGATCTCAGGA
rJMFF044A15+ ACAAGCAGAAAAAATAATTGGATGCTCTGCAGATGAGCTTGACAGGCTGAGATCTCAGGA
rJMFF043I21+ ACAAGCAGAAAAAATAATTGGATGCTCTGCAGATGAGCTTGACAGGCTGAGATCTCAGGA
                      ____________________________________________________________
consensus ACAAGCAGAAAAAATAATTGGATGCTCTGCAGATGAGCTTGACAGGCTGAGATCTCAGGA
 
. : . : . : . : . : . :
rJMSF020A13+ TGGAGATAGTAGTGCTTACCAAATGAAATTGAAGGAAGCAACATGGGTTCCTTATCTTTT
rJMFF033K02+ TGGAGATAGTAGTGCTTACCAAATGAAATTGAAGGAAGCAACATGGGTTCCTTATCTTTT
rJMSF041F22+ TGGAGATAGTAGTGCTTACCAAATGAAATTGAAGGAAGCAACATGGGTTCCTTATCTTTT
rJMFF031A20+ TGGAGATAGTAGTGCTTACCAAATGAAATTGAAGGAAGCAACATGGGTTCCTTATCTTTT
rJMFF043J01+ TGGAGATAGTAGTGCTTACCAAATGAAATTGAAGGAAGCAACATGGGTTCCTTATCTTTT
rJMFF044A15+ TGGAGATAGTAGTGCTTACCAAATGAAATTGAAGGAAGCAACATGGGTTCCTTATCTTTT
rJMFF043I21+ TGGAGATAGTAGTGCTTACCAAATGAAATTGAAGGAAGCAACATGGGTTCCTTATCTTTT
                      ____________________________________________________________
consensus TGGAGATAGTAGTGCTTACCAAATGAAATTGAAGGAAGCAACATGGGTTCCTTATCTTTT
 
. : . : . : . : . : . :
rJMSF020A13+ CCGGGTCAGCGTTACCCCTCAAGAGTACAATAACGAAAAGAGGCAAAGGATAACAGTCAG
rJMFF033K02+ CCGGGTCAGCGTTACCCCTCAAGAGTACAATAACGAAAAGAGGCAAAGGATAACAGTCAG
rJMSF041F22+ CCGGGTCAGCGTTACCCCTCAAGAGTACAATAACGAAAAGAGGCAAAGGATAACAGTCAG
rJMFF031A20+ CCGGGTCAGCGTTACCCCTCAAGAGTACAATAACGAAAAGAGGCAAAGGATAACAGTCAG
rJMFF043J01+ CCGGGTCAGCGTTACCCCTCAAGAGTACAATAACGAAAAGAGGCAAAGGATAACAGTCAG
rJMFF044A15+ CCGGGTCAGCGTTACCCCTCAAGAGTACAATAACGAAAAGAGGCAAAGGATAACAGTCAG
rJMFF043I21+ CCGGGTCAGCGTTACCCCTCAAGAGTACAATAACGAAAAGAGGCAAAGGATAACAGTCAG
                      ____________________________________________________________
consensus CCGGGTCAGCGTTACCCCTCAAGAGTACAATAACGAAAAGAGGCAAAGGATAACAGTCAG
 
. : . : . : . : . : . :
rJMSF020A13+ AGCGGCGGCTCCAGTTGATTTTGCAGCTGAATCCAGATACTTTCTGGAAGAAATGGCTAA
rJMFF033K02+ AGCGGCGGCTCCAGTTGATTTTGCAGCTGAATCCAGATACTTTCTGGAAGAAATGGCTAA
rJMSF041F22+ AGCGGCGGCTCCAGTTGATTTTGCAGCTGAATCCAGATACTTTCTGGAAGAAATGGCTAA
rJMFF031A20+ AGCGGCGGCTCCAGTTGATTTTGCAGCTGAATCCAGATACTTTCTGGAAGAAATGGCTAA
rJMFF043J01+ AGCGGCGGCTCCAGTTGATTTTGCAGCTGAATCCAGATACTTTCTGGAAGAAATGGCTAA
rJMFF044A15+ AGCGGCGGCTCCAGTTGATTTTGCAGCTGAATCCAGATACTTTCTGGAAGAAATGGCTAA
rJMFF043I21+ AGCGGCGGCTCCAGTTGATTTTGCAGCTGAATCCAGATACTTTCTGGAAGAAATGGCTAA
                      ____________________________________________________________
consensus AGCGGCGGCTCCAGTTGATTTTGCAGCTGAATCCAGATACTTTCTGGAAGAAATGGCTAA
 
. : . : . : . : . : . :
rJMSF020A13+ GATGAACATCTGTGTATAAC
rJMFF033K02+ GATGAACATCTGTGTATAACTGGCTTTTGTAAATTAAAACAATCAGAGTATT
rJMSF041F22+ GATGAACATCTGTGTATAACTGGCTTTTGTAAATTAAAACAATCAGAGTATT
rJMFF031A20+ GATGAACATCTGTGTATAACTGGCTTTTGTAAATTAAAACAATCAGAGTATTTTCTTTCA
rJMFF043J01+ GATGAACATCTGTGTATAACTGGCTTTTGTAAATTAAAACAATCAGAGTATTTTCTTTCA
rJMFF044A15+ GATGAACATCTGTGTATAACTGGCTTTTGTAAATTAAAACAATCAGAGTATTTTCTTTCA
rJMFF043I21+ GATGAACATCTGTGTATAACTGGCTTTTGTAAATTAAAACAATCAGAGTATTTTCTTTCA
                      ____________________________________________________________
consensus GATGAACATCTGTGTATAACTGGCTTTTGTAAATTAAAACAATCAGAGTATTTTCTTTCA
 
. : . : . : . : . : . :
rJMFF031A20+ CTAAATC
rJMFF043J01+ CTAAATCTAGATTATTGGTTCCTTT
rJMFF044A15+ CTAAATCTAGATTATTGGTTCCTTTGCTGATCAGATCTGTTAGATTTGCATTTTGCAGTC
rJMFF043I21+ CTAAATCTAGATTATTGGTTCCTTTGCTGATCAGATCTGTTAGATTTGCATTTTGCAGTC
                      ____________________________________________________________
consensus CTAAATCTAGATTATTGGTTCCTTTGCTGATCAGATCTGTTAGATTTGCATTTTGCAGTC
 
. : . : . : . : . : . :
rJMFF044A15+ CAATCCTATTCCTATCCATTAAACAATGCTAAATAAAACTGGAAAAAAGGCAGATTCTTT
rJMFF043I21+ CAATCCTATTCCTATCCATTAAACAATGCTAAATAAAACTGGAAAAAAGGCAGATTCTTT
                      ____________________________________________________________
consensus CAATCCTATTCCTATCCATTAAACAATGCTAAATAAAACTGGAAAAAAGGCAGATTCTTT