Previous Contig 010323:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043I18Sequence640010323 (6)gb:ATAC009853_15430483e-73Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc483010323 (6)gb:CAR275312_16451974e-17Cicer arietinum partial mRNA for RAS-like protein.
JMSF006E17Sequence466004792 (2)364010323 (6)gb:CAR275312_16451974e-13Cicer arietinum partial mRNA for RAS-like protein.
JMSF006G19Sequence418010323 (6)gb:BT006190_16390826e-40Arabidopsis thaliana clone C00163 (i) putative RAS-related protein ARA-1 (At1g05
JMSF013D04Sequence347010323 (6)pir|T06443|T064431e-29GTP-binding protein - garden pea>gb:PEAGTPBP01_1699683 Pisum sativum mRNA for GT748010323 (6)gb:ATAC009853_15430484e-82Arabidopsis thaliana chromosome III BAC F21O3 genomic sequence, complete sequenc

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF006G19- GCGA
                      ____________________________________________________________
consensus GCGA
 
. : . : . : . : . : . :
JMSF013D04- GATTCTTTTCCTTACAGATAAAGATTACGGGCTGCTGCGTTTACTCTCTCTGT
JMSF006G19- AATCTTTGATTCTTTTCCTTACAGATAAAGATTACGGGCTGCTGCGTTTACTCTCTCTGT
JMFF043I18- GT
                      ____________________________________________________________
consensus AATCTTTGATTCTTTTCCTTACAGATAAAGATTACGGGCTGCTGCGTTTACTCTCTCTGT
 
. : . : . : . : . : . :
JMSF013D04- AACCCAGAACTTCTTCTTCTCTTCTGAGCAAGAAAGAGAGAGAGAGAGAGAGAGGGAATG
JMSF006G19- AACCCAGAACTTCTTCTTCTCTTCTGAGCAAGAAAGAGAGAGAGAGAGAGAGAGGGAATG
JMFF043I18- AACCCAGAACTTCTTCTTCTCTTCTGAGCAAGAAAGAGAGAGAGAGAGAGAGAGGGAATG
rJMSF013D04+ AGAGAGAGAGAGAGAGAGGGAATG
                      ____________________________________________________________
consensus AACCCAGAACTTCTTCTTCTCTTCTGAGCAAGAAAGAGAGAGAGAGAGAGAGAGGGAATG
 
. : . : . : . : . : . :
JMSF013D04- GGGGAGGAAGAAGGGGAGGAGTACCTTTTCAAGGTGGTAGTAATCGGCGACTCGGCGGTG
JMSF006G19- GGGGAGGAAGAAGGGGAGGAGTACCTTTTCAAGGTGGTAGTAATCGGCGACTCGGCGGTG
JMFF043I18- GGGGAGGAAGAAGGGGAGGAGTACCTTTTCAAGGTGGTAGTAATCGGCGACTCGGCGGTG
rJMSF013D04+ GGGGAGGAAGAAGGGGAGGAGTACCTTTTCAAGGTGGTAGTAATCGGCGACTCGGCGGTG
                      ____________________________________________________________
consensus GGGGAGGAAGAAGGGGAGGAGTACCTTTTCAAGGTGGTAGTAATCGGCGACTCGGCGGTG
 
. : . : . : . : . : . :
JMSF013D04- GGCAAATCCAACTTGCTATCGCGGTTCGCCAGGGACGAGTTCGACCACAACTCCAAAGCC
JMSF006G19- GGCAAATCCAACTTGCTATCGCGGTTCGCCAGGGACGAGTTCGACCACAACTCCAAAGCC
JMFF043I18- GGCAAATCCAACTTGCTATCGCGGTTCGCCAGGGACGAGTTCGACCACAACTCCAAAGCC
rJMSF013D04+ GGCAAATCCAACTTGCTATCGCGGTTCGCCAGGGACGAGTTCGACCACAACTCCAAAGCC
                      ____________________________________________________________
consensus GGCAAATCCAACTTGCTATCGCGGTTCGCCAGGGACGAGTTCGACCACAACTCCAAAGCC
 
. : . : . : . : . : . :
JMSF013D04- ACCATTGGAGTGGAGTTCCAGACGCAGGTGGTGGAGGTCGACGGCAAGGAGGTGAAGGCG
JMSF006G19- ACCATTGGAGTGGAGTTCCAGACGCAGGTGGTGGAGGTCGACGGCAAGGAGGTGAAGGCG
JMFF043I18- ACCATTGGAGTGGAGTTCCAGACGCAGGTGGTGGAGGTCGACGGCAAGGAGGTGAAGGCG
rJMSF013D04+ ACCATTGGAGTGGAGTTCCAGACGCAGGTGGTGGAGGTCGACGGCAAGGAGGTGAAGGCG
                      ____________________________________________________________
consensus ACCATTGGAGTGGAGTTCCAGACGCAGGTGGTGGAGGTCGACGGCAAGGAGGTGAAGGCG
 
. : . : . : . : . : . :
JMSF013D04- CAGGTCTGGGACACCGCCGGCCAAGAACGCTTCCGCGCCGTCACCTCCGCGTA
JMSF006G19- CAGGTCTGGGACACCGCCGGCCAAGAACGCTTCCGCGCCGTCACCTCCGCGTACTACAGA
JMFF043I18- CAGGTCTGGGACACCGCCGGCCAAGAACGCTTCCGCGCCGTCACCTCCGCGTACTACAGA
rJMSF013D04+ CAGGTCTGGGACACCGCCGGCCAAGAACGCTTCCGCGCCGTCACCTCCGCGTACTACAGA
                      ____________________________________________________________
consensus CAGGTCTGGGACACCGCCGGCCAAGAACGCTTCCGCGCCGTCACCTCCGCGTACTACAGA
 
. : . : . : . : . : . :
JMSF006G19- GGCGCCGTCGGCGCCCTCATTGTCTACGACATCACCCGGAAGACAACCTTTGAG
JMFF043I18- GGCGCCGTCGGCGCCCTCATTGTCTACGACATCACCCGGAAGACAACCTTTGAGAACATC
rJMSF013D04+ GGCGCCGTCGGCGCCCTCATTGTCTACGACATCACCCGGAAGACAACCTTTGAGAACATC
                      ____________________________________________________________
consensus GGCGCCGTCGGCGCCCTCATTGTCTACGACATCACCCGGAAGACAACCTTTGAGAACATC
 
. : . : . : . : . : . :
JMFF043I18- AAACGCTGGCTCGAAGAGCTCAACACTCATTGTGATACTACGGTGGCAAGGATGCTGGTT
rJMSF013D04+ AAACGCTGGCTCGAAGAGCTCAACACTCATTGTGATACTACGGTGGCAAGGATGCTGGTT
                      ____________________________________________________________
consensus AAACGCTGGCTCGAAGAGCTCAACACTCATTGTGATACTACGGTGGCAAGGATGCTGGTT
 
. : . : . : . : . : . :
JMFF043I18- GGAAACAAGTGCGATTTGGAGAGCATTCGGGATGTGAGCGTGGAAGAGGGCAAGCTCCTT
rJMSF013D04+ GGAAACAAGTGCGATTTGGAGAGCATTCGGGATGTGAGCGTGGAAGAGGGCAAGCTCCTT
rJMFF043I18+ CCTT
                      ____________________________________________________________
consensus GGAAACAAGTGCGATTTGGAGAGCATTCGGGATGTGAGCGTGGAAGAGGGCAAGCTCCTT
 
. : . : . : . : . : . :
JMFF043I18- GCAGAAGAGGAAGGGTTGTTCTTCATAGAGACGTCCGCCCTCGACTCCACCAACGTCAAC
rJMSF013D04+ GCAGAAGAGGAAGGGTTGTTCTTCATAGAGACGTCCGCCCTCGACTCCACCAACGTCAAC
rJMSF006E17+ AACGTCAAC
rJMFF043I18+ GCAGAAGAGGAAGGGTTGTTCTTCATAGAGACGTCCGCCCTCGACTCCACCAACGTCAAC
                      ____________________________________________________________
consensus GCAGAAGAGGAAGGGTTGTTCTTCATAGAGACGTCCGCCCTCGACTCCACCAACGTCAAC
 
. : . : . : . : . : . :
JMFF043I18- ACCGCC-TTGAGATTGTCATTCGCGACATCTACAAGAACGTTAGCAGGAAGCTGCTNCAC
rJMSF013D04+ ACCGCCTTTGAGATTGTCATTCGCGACATCTACAAGAACGTTAGCAGGAAGCTGCTCAAC
rJMSF006E17+ ACCGCCTTTGAGATTGTCATTCGCGACATCTACAAGAACGTTAGCAGGAAGCTGCTCAAC
rJMFF043I18+ ACCGCC-TTGAGATTGTCATTCGCGACATTTACAAGAACGTTAGCAGGAAGCTGCTCAAC
                      ____________________________________________________________
consensus ACCGCC-TTGAGATTGTCATTCGCGACATCTACAAGAACGTTAGCAGGAAGCTGCTCAAC
 
. : . : . : . : . : . :
JMFF043I18- TCCGACTCCTACAAGGCCGAGCTGTCTGTAAACCGGGTT
rJMSF013D04+ TCCGACTCCTACAAGGCCGAGCTGTCTGTAAACCGGGTTAGCCTCGCGAATGGAGCTGAC
rJMSF006E17+ TCCGACTCCTACAAGGCCGAGCTGTCTGTAAACCGGGTTAGCCTCGCGAATGGAGCTGAC
rJMFF043I18+ TCCGACTCCTACAAGGCCGAGCTGTCTGTAAACCGGGTTAGCCTCGCGAATGGAGCTGAC
                      ____________________________________________________________
consensus TCCGACTCCTACAAGGCCGAGCTGTCTGTAAACCGGGTTAGCCTCGCGAATGGAGCTGAC
 
. : . : . : . : . : . :
rJMSF013D04+ ATGTCGAAGCAAAACAAGAGCAGCTACGCGTGCTGCTCCTCCTCCTCCTAGTAATTTTGT
rJMSF006E17+ ATGTCGAAGCAAAACAAGAGCAGCTACGCGTGCTGCTCCTCCTCCTCCTAGTAATTTTGT
rJMFF043I18+ ATGTCGAAGCAAAACAAGAGCAGCTACGCGTGCTGCTCCTCCTCCTCCTAGTAATTTTGT
                      ____________________________________________________________
consensus ATGTCGAAGCAAAACAAGAGCAGCTACGCGTGCTGCTCCTCCTCCTCCTAGTAATTTTGT
 
. : . : . : . : . : . :
rJMSF013D04+ TTTGTTTTCCCACGTTGTTTTAGCTGTATGTTAGACTTTTGGATGTATGTTTATTCTTTT
rJMSF006E17+ TTTGTTTTCCCACGTTGTTTTAGCTGTATGTTAGACTTTTGGATGTATGTTTATTCTTTT
rJMFF043I18+ TTTGTTTTCCCACGTTGTTTTAGCTGTATGTTAGACTTTTGGATGTATGTTTATTCTTTT
                      ____________________________________________________________
consensus TTTGTTTTCCCACGTTGTTTTAGCTGTATGTTAGACTTTTGGATGTATGTTTATTCTTTT
 
. : . : . : . : . : . :
rJMSF006E17+ TGATGAATTAGGGCAATGAGGGTCTCTGAGGTTGCCTTATGGAATGGCATATNTATTGTA
rJMFF043I18+ TGATGAATTAGGGCAATGAGGGTCTCTGAGGTTGCCTTATGGAATGGCATATTTATTGTA
                      ____________________________________________________________
consensus TGATGAATTAGGGCAATGAGGGTCTCTGAGGTTGCCTTATGGAATGGCATATTTATTGTA
 
. : . : . : . : . : . :
rJMSF006E17+ TGTTTCTTGGTCAGGCCAGTGAAGTTTCAAAGATGCAGCAGAACAAGTTAACATG
rJMFF043I18+ TGTTTCTTGGTCAGGCCAGTGAAGTTTCAAAGATGCAGCAGAACAAGTTAACATGCACTC
                      ____________________________________________________________
consensus TGTTTCTTGGTCAGGCCAGTGAAGTTTCAAAGATGCAGCAGAACAAGTTAACATGCACTC
 
. : . : . : . : . : . :
rJMFF043I18+ TGCAGTGTTCTTGTTTATTTGGAGTTGGTATGTGAATTTCTTGGTGATATTGTCCGCTCT
                      ____________________________________________________________
consensus TGCAGTGTTCTTGTTTATTTGGAGTTGGTATGTGAATTTCTTGGTGATATTGTCCGCTCT