Previous Contig 010322:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043I15Sequence646006204 (3)gb:AY100638_15769455e-54Prunus cerasus putative sorbitol transporter (SorT2) mRNA, complete cds.633010322 (4)gb:BVU64903_16432311e-35Beta vulgaris putative sugar transporter (BvcDNA-397) mRNA, complete cds.
JMFF045D09Sequence635006204 (3)gb:AY100638_15769454e-40Prunus cerasus putative sorbitol transporter (SorT2) mRNA, complete cds.605010322 (4)gb:AP004365_18408286e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P045
JMSF024D22Sequence658006204 (3)755010322 (4)gb:BVU64903_16432313e-62Beta vulgaris putative sugar transporter (BvcDNA-397) mRNA, complete cds.
JMSF039M08Sequence611007320 (4)gb:AC134346_17417515e-50Oryza sativa (japonica cultivar-group) chromosome 5 clone P0018A03, complete seq847010322 (4)gb:BVU64903_16432312e-59Beta vulgaris putative sugar transporter (BvcDNA-397) mRNA, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF024D22+ CNTCCGGCGAGTGGCGCG
                      ____________________________________________________________
consensus CNTCCGGCGAGTGGCGCG
 
. : . : . : . : . : . :
rJMSF024D22+ GACAAGGTGCATGGAGAGAGCTGCTCTGCCCGACGGCGCCGATCCGCCGCATGTTGGTTA
rJMSF039M08+ CGATCCGCCGCATGTTGGTTA
                      ____________________________________________________________
consensus GACAAGGTGCATGGAGAGAGCTGCTCTGCCCGACGGCGCCGATCCGCCGCATGTTGGTTA
 
. : . : . : . : . : . :
rJMSF024D22+ CGGCCATCGGAATAAACTTCTTCATGCAAGCCTCCGGGAACGACGCGGTGGTTTACTACA
rJMSF039M08+ CGGCCATCGGAATAAACTTCTTCATGCAAGCCTCCGGGAACGACGCGGTGGTTTACTACA
                      ____________________________________________________________
consensus CGGCCATCGGAATAAACTTCTTCATGCAAGCCTCCGGGAACGACGCGGTGGTTTACTACA
 
. : . : . : . : . : . :
rJMSF024D22+ CGCCGTTGGTGTTCAAATCCGCCGGAATAACTAACCGGAAAGGCCAAATCGGAGTAACAA
rJMSF039M08+ CGCCGTTGGTGTTCAAATCCGCCGGAATAACTAACCGGAAAGGCCAAATCGGAGTAACAA
                      ____________________________________________________________
consensus CGCCGTTGGTGTTCAAATCCGCCGGAATAACTAACCGGAAAGGCCAAATCGGAGTAACAA
 
. : . : . : . : . : . :
rJMSF024D22+ TCATCATGGGCATGGCTAAAACCACCTTTGTTTTGGTCTCAGCACTTTTCCTCGACAATT
rJMSF039M08+ TCATCATGGGCATGGCTAAAACCACCTTTGTTTTGGTCTCAGCACTTTTCCTCGACAATT
                      ____________________________________________________________
consensus TCATCATGGGCATGGCTAAAACCACCTTTGTTTTGGTCTCAGCACTTTTCCTCGACAATT
 
. : . : . : . : . : . :
rJMSF024D22+ TCGGGAGACGGCCCATGTTACTATTGGGCACAGTGGGCCAGGCCCTATCCCTTGCTGGGC
rJMSF039M08+ TCGGGAGACGGCCCATGTTACTATTGGGCACAGTGGGCCAGGCCCTATCCCTTGCTGGGC
                      ____________________________________________________________
consensus TCGGGAGACGGCCCATGTTACTATTGGGCACAGTGGGCCAGGCCCTATCCCTTGCTGGGC
 
. : . : . : . : . : . :
rJMSF024D22+ TCGGGCTGGGCTCAACATATCTCCTCCACGCCCATCACAAGCCCATTTGGGCCATCGCAT
rJMSF039M08+ TCGGGCTGGGCTCAACATATCTCCTCCACGCCCATCACAAGCCCATTTGGGCCATCGCAT
rJMFF045D09+ AGCCCATTTGGGCCATCGCAT
rJMFF043I15+ ACGCCCATCACAAGCCCATTTGGGCCATCGCAT
                      ____________________________________________________________
consensus TCGGGCTGGGCTCAACATATCTCCTCCACGCCCATCACAAGCCCATTTGGGCCATCGCAT
 
. : . : . : . : . : . :
rJMSF024D22+ TGTGTGTTCTCGCGGTTTGCGCCGACGTCTCGTTCTTCTCAATCGGGCTCGGGCCGGTCA
rJMSF039M08+ TGTGTGTTCTCGCGGTTTGCGCCGACGTCTCGTTCTTCTCAATCGGGCTCGGGCCGGTCA
rJMFF045D09+ GTGTTGTTCTCGCGGTTTGCGCCGACGTCTCGTTCTTCTCAATCGGGCTCGGGCCGGTCA
rJMFF043I15+ TGTGTGTTCTCGCGGTTTGCGCCGACGTCTCGTTCTTCTCAATCGGGCTCGGGCCGGTCA
                      ____________________________________________________________
consensus TGTGTGTTCTCGCGGTTTGCGCCGACGTCTCGTTCTTCTCAATCGGGCTCGGGCCGGTCA
 
. : . : . : . : . : . :
rJMSF024D22+ CATGGGTCTACTCAGCTGAGATTTTCCCACTCAGACTCAGGGCCCAAGGCTCGGCCCTAG
rJMSF039M08+ CATGGGTCTACTCAGCTGAGATTTTCCCACTCAGACTCAGGGCCCAAGGCTCGGCCCTAG
rJMFF045D09+ CATGGGTCTACTCAGCTGAGATTTTCCCACTCAGACTCAGGGCCCAAGGCTCGGCCCTAG
rJMFF043I15+ CATGGGTCTACTCAGCTGAGATTTTCCCACTCAGACTCAGGGCCCAAGGCTCGGCCCTAG
                      ____________________________________________________________
consensus CATGGGTCTACTCAGCTGAGATTTTCCCACTCAGACTCAGGGCCCAAGGCTCGGCCCTAG
 
. : . : . : . : . : . :
rJMSF024D22+ CAGTTTCAGTGAATAGGTTGGTGAGTGGAGTTGTCTCAGCCACATTTCTTAGTATTTCCC
rJMSF039M08+ CAGTTTCAGTGAATAGGTTGGTGAGTGGAGTTGTCTCAGCCACATTTCTTAGTATTTCCC
rJMFF045D09+ CAGTTTCAGTGAATAGGTTGGTGAGTGGAGTTGTCTCAGCCACATTTCTTAGTATTTCCC
rJMFF043I15+ CAGTTTCAGTGAATAGGTTGGTGAGTGGAGTTGTCTCAGCCACATTTCTTAGTATTTCCC
                      ____________________________________________________________
consensus CAGTTTCAGTGAATAGGTTGGTGAGTGGAGTTGTCTCAGCCACATTTCTTAGTATTTCCC
 
. : . : . : . : . : . :
rJMSF024D22+ AAAAAATAACGTTTGGAGGAATGTTTTTTGTGCTTTCTGGGGTTATGGTGGTGGCTACAC
rJMSF039M08+ AAAAAATAACGTTTGGAGGAATGTTTTTTGTGCTTTCTGGGGTTATGGTGGTGGCTACAC
rJMFF045D09+ AAAAA--AACGTTTGGAGGAATGTTTTTTGTGCTTTCTGGGGTTATGGTGGTGGCTACAC
rJMFF043I15+ AAAAAATAACGTTTGGAGGAATGTTTTTTGTGCTTTCTGGGGTTATGGTGGTGGCTACAC
                      ____________________________________________________________
consensus AAAAAATAACGTTTGGAGGAATGTTTTTTGTGCTTTCTGGGGTTATGGTGGTGGCTACAC
 
. : . : . : . : . : . :
rJMSF024D22+ TATTCTTTTACTTGCTATTGCCAGAGACCAAAGGCATGAGCCTAGAGGAAATAGGGTCAC
rJMSF039M08+ TATTCTTTTACTTGCTATTGCCAGAGACCAAAGGCATGAGCCTAGAGGAAATAGGGTCAC
rJMFF045D09+ TATTCTTTTACTTGCTATTGCCAGAGACCAAAGGCATGAGCCTAGAGGAAATAGGGTCAC
rJMFF043I15+ TATTCTTTTACTTGCTATTGCCAGAGACCAAAGGCATGAGCCTAGAGGAAATAGGGTCAC
                      ____________________________________________________________
consensus TATTCTTTTACTTGCTATTGCCAGAGACCAAAGGCATGAGCCTAGAGGAAATAGGGTCAC
 
. : . : . : . : . : . :
rJMSF024D22+ TATTTGAGGACAAACAAGATAATGGTGAAAAGGATAAAGATATTGAATTGGAGAGATAGA
rJMSF039M08+ TATTTGAGGACAAACAAGATAATGGTGAAAAGGATAAAGATATTGAATTGGAGAGATAGA
rJMFF045D09+ TATTTGAGGACAAACAAGATAATGGTGAAAAGGATAAAGATATTGAATTGGAGAGATAGA
rJMFF043I15+ TATTTGAGGACAAACAAGATAATGGTGAAAAGGATAAAGATATTGAATTGGAGAGATAGA
                      ____________________________________________________________
consensus TATTTGAGGACAAACAAGATAATGGTGAAAAGGATAAAGATATTGAATTGGAGAGATAGA
 
. : . : . : . : . : . :
rJMSF024D22+ TAGGGCATGGAGCAATT
rJMSF039M08+ TAGGGCATGGAGCAATTTCTTGTATGGTTTTATTAGTTATATATAGTGTGCTAATCCATA
rJMFF045D09+ TAGGGCATGGAGCAATTTCTTGTATGGTTTTATTAGTTATATATAGTGTGCTAATCCATA
rJMFF043I15+ TAGGGCATGGAGCAATTTCTTGTATGGTTTTATTAGTTATATATAGTGTGCTAATCCATA
                      ____________________________________________________________
consensus TAGGGCATGGAGCAATTTCTTGTATGGTTTTATTAGTTATATATAGTGTGCTAATCCATA
 
. : . : . : . : . : . :
rJMSF039M08+ ATATTTAGGAGTTTGATGTGATTATTTAGTATATTTAATTAAGAATATTTGTGTTTCATT
rJMFF045D09+ ATATTTAGGAGTTTGATGTGATTATTTAGTATATTTAATTAAGAATATTTGTGTTTCATT
rJMFF043I15+ ATATTTAGGAGTTTGATGTGATTATTTAGTATATTTAATTAAGAATATTTGTGTTTCATT
                      ____________________________________________________________
consensus ATATTTAGGAGTTTGATGTGATTATTTAGTATATTTAATTAAGAATATTTGTGTTTCATT
 
. : . : . : . : . : . :
rJMSF039M08+ ATGTAATTGAGTGAGTTAGTGGCATAAGCCACCTGTATTGTAATGA
rJMFF045D09+ ATGTAATTGAGTGAGTTAGTGGCATAAGCCACCTGTATTGTAATGATTATTTCAAACATA
rJMFF043I15+ ATGTAATTGAGTGAGTTAGTGGCATAAGCCACCTGTATTGTAATGATTATTTCAAACATA
                      ____________________________________________________________
consensus ATGTAATTGAGTGAGTTAGTGGCATAAGCCACCTGTATTGTAATGATTATTTCAAACATA
 
. : . : . : . : . : . :
rJMFF045D09+ ATGAAAAACGTAATGATGCGTGTTAGTTGTCAAAAAAAAAAAAAA
rJMFF043I15+ ATGAAAAACGTAATGATGCGTGTTAGTTGTCTCGAAAAAAAAAAAAAAACTCTCCAGGGT
                      ____________________________________________________________
consensus ATGAAAAACGTAATGATGCGTGTTAGTTGTCTCGAAAAAAAAAAAAAAACTCTCCAGGGT