Previous Contig 010315:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF009P01Sequence583001030 (5)gb:AP000969_18206851e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0011D01711010315 (5)pir|T04894|T048941e-36hypothetical protein F18F4.200 - Arabidopsis thaliana>gb:ATCHRIV52_1545848 Arabi
JMFF020G17Sequence551001030 (5)gb:AP000969_18206852e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0011D01750010315 (5)pir|T04894|T048942e-36hypothetical protein F18F4.200 - Arabidopsis thaliana>gb:ATCHRIV52_1545848 Arabi
JMFF023I02Sequence432001030 (5)gb:AP000969_18206858e-14Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0011D01714010315 (5)pir|T04894|T048942e-36hypothetical protein F18F4.200 - Arabidopsis thaliana>gb:ATCHRIV52_1545848 Arabi
JMFF043H20Sequence605001030 (5)gb:AP000969_18206851e-30Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0011D01617010315 (5)pir|T04894|T048941e-32hypothetical protein F18F4.200 - Arabidopsis thaliana>gb:ATCHRIV52_1545848 Arabi
JMFF046L23Sequence536001030 (5)gb:AP000969_18206852e-27Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0011D01109010315 (5)

Alignment

This contig is upended


. : . : . : . : . : . :
rJMFF020G17+ CGCCATCAANCAAAAAGCACAAATAGTGGACTGATTCTTCAAAAACAAGCT
rJMFF023I02+ TTCAAAAACAAGCT
rJMFF009P01+ CAAGCT
                      ____________________________________________________________
consensus CGCCATCAANCAAAAAGCACAAATAGTGGACTGATTCTTCAAAAACAAGCT
 
. : . : . : . : . : . :
rJMFF020G17+ GGAGAAGTTGTGCTGTTTGGTAGAAAGCTTTTACAGGAAAGTGGTGGTTTTCTGCTGAAT
rJMFF023I02+ GGAGAAGTTGTGCTGTTTGGTAGAAAGCTTTTACAGGAAAGTGGTGGTTTTCTGCTGAAT
rJMFF009P01+ GGAGAAGTTGTGCTGTTTGGTAGAAAGCTTTTACAGGAAAGTGGTGGTTTTCTGCTGAAT
                      ____________________________________________________________
consensus GGAGAAGTTGTGCTGTTTGGTAGAAAGCTTTTACAGGAAAGTGGTGGTTTTCTGCTGAAT
 
. : . : . : . : . : . :
rJMFF020G17+ AGCCAATCCAACCAGACCATTGGGATTGCAGCACTTTTTGGCTGGGGAATGGCAATTATT
rJMFF023I02+ AGCCAATCCAACCAGACCATTGGGATTGCAGCACTTTTTGGCTGGGGAATGGCAATTATT
rJMFF009P01+ AGCCAATCCAACCAGACCATTGGGATTGCAGCACTTTTTGGCTGGGGAATGGCAATTATT
rJMFF043H20+ GGGGAATGGCAATTATT
                      ____________________________________________________________
consensus AGCCAATCCAACCAGACCATTGGGATTGCAGCACTTTTTGGCTGGGGAATGGCAATTATT
 
. : . : . : . : . : . :
rJMFF020G17+ TACATTGGTGGACGCCTGCCGCAAATTCGCTTAAATTTCAGGAGGGGAAATGTTGAAGGG
rJMFF023I02+ TACATTGGTGGACGCCTGCCGCAAATTCGCTTAAATTTCAGGAGGGGAAATGTTGAAGGG
rJMFF009P01+ TACATTGGTGGACGCCTGCCGCAAATTCGCTTAAATTTCAGGAGGGGAAATGTTGAAGGG
rJMFF043H20+ TACATTGGTGGACGCCTGCCGCAAATTCGCTTAAATTTCAGGAGGGGAAATGTTGAAGGG
                      ____________________________________________________________
consensus TACATTGGTGGACGCCTGCCGCAAATTCGCTTAAATTTCAGGAGGGGAAATGTTGAAGGG
 
. : . : . : . : . : . :
rJMFF020G17+ CTAAATCCACTAATGTTCATGTTTGCTCTGTTTGGTAATGTCACATATGTAGCAAGCATT
rJMFF023I02+ CTAAATCCACTAATGTTCATGTTTGCTCTGTTTGGTAATGTCACATATGTAGCAAGCATT
rJMFF009P01+ CTAAATCCACTAATGTTCATGTTTGCTCTGTTTGGTAATGTCACATATGTAGCAAGCATT
rJMFF043H20+ CTAAATCCACTAATGTTCATGTTTGCTCTGTTTGGTAATGTCACATATGTAGCAAGCATT
                      ____________________________________________________________
consensus CTAAATCCACTAATGTTCATGTTTGCTCTGTTTGGTAATGTCACATATGTAGCAAGCATT
 
. : . : . : . : . : . :
rJMFF020G17+ CTTGTCAGCAGCCTGGACTGGTCAAAACTTGGACCAAACATGCCCTGGCTGGTTGATGCA
rJMFF023I02+ CTTGTCAGCAGCCTGGACTGGTCAAAACTTGGACCAAACATGCCCTGGCTGGTTGATGCA
rJMFF009P01+ CTTGTCAGCAGCCTGGACTGGTCAAAACTTGGACCAAACATGCCCTGGCTGGTTGATGCA
rJMFF043H20+ CTTGTCAGCAGCCTGGACTGGTCAAAACTTGGACCAAACATGCCCTGGCTGGTTGATGCA
                      ____________________________________________________________
consensus CTTGTCAGCAGCCTGGACTGGTCAAAACTTGGACCAAACATGCCCTGGCTGGTTGATGCA
 
. : . : . : . : . : . :
rJMFF020G17+ AGTGGATGTGTACTCCTTGATACCTTAATACTAATTCAGTTCTTCTATTACCGTAATCGT
rJMFF023I02+ AGTGGATGTGTACTCCTTGATACCTTAATACTAATTCAGTTCTTCTATTACCGTAATCGT
rJMFF009P01+ AGTGGATGTGTACTCCTTGATACCTTAATACTAATTCAGTTCTTCTATTACCGTAATCGT
rJMFF043H20+ AGTGGATGTGTACTCCTTGATACCTTAATACTAATTCAGTTCTTCTATTACCGTAATCGT
                      ____________________________________________________________
consensus AGTGGATGTGTACTCCTTGATACCTTAATACTAATTCAGTTCTTCTATTACCGTAATCGT
 
. : . : . : . : . : . :
rJMFF020G17+ GTATCGGATAAAGTAGCGAGTAAGCATGAAAATGGCAGCCCTTAGAATTGTCCCCAAGAA
rJMFF023I02+ GTATCGGATAAAGTAGCGAGTAAGCATGAAAATGGCAGCCCTTAGAATTGTCCCCAAGAA
rJMFF009P01+ GTATCGGATAAAGTAGCGAGTAAGCATGAAAATGGCAGCCCTTAGAATTGTCCCCAAGAA
rJMFF043H20+ GTATCGGATAAAGTAGCGAGTAAGCATGAAAATGGCAGCCCTTAGAATTGTCCCCAAGAA
                      ____________________________________________________________
consensus GTATCGGATAAAGTAGCGAGTAAGCATGAAAATGGCAGCCCTTAGAATTGTCCCCAAGAA
 
. : . : . : . : . : . :
rJMFF020G17+ GAACATATTTTGCAGGTCAAGTGAACCAACCAATATTTGGATCATACTACATCTGACTGC
rJMFF023I02+ GAACATATTTTGCAGGTCAAGTGAACCAACCAATATTTGGATCATACTACATCTGACTGC
rJMFF009P01+ GAACATATTTTGCAGGTCAAGTGAACCAACCAATATTTGGATCATACTACATCTGACTGC
rJMFF043H20+ GAACATATTTTGCAGGTCAAGTGAACCAACCAATATTTGGATCATACTACATCTGACTGC
                      ____________________________________________________________
consensus GAACATATTTTGCAGGTCAAGTGAACCAACCAATATTTGGATCATACTACATCTGACTGC
 
. : . : . : . : . : . :
rJMFF020G17+ TGTTATTTCTTGAAAAGCTGGGGAAAGCCATAGGGGCAACCTCTCTACAAGTACTGCACT
rJMFF023I02+ TGTTATTTCTTGAAAAGCTGGGGAAAGCCATAGGGGCAACCTCTCTACAAGTACTGCACT
rJMFF009P01+ TGTTATTTCTTGAAAAGCTGGGGAAAGCCATAGGGGCAACCTCTCTACAAGTACTGCACT
rJMFF043H20+ TGTTATTTCTTGAAAAGCTGGGGAAAGCCATAGGGGCAACCTCTCTACAAGTACTGCACT
                      ____________________________________________________________
consensus TGTTATTTCTTGAAAAGCTGGGGAAAGCCATAGGGGCAACCTCTCTACAAGTACTGCACT
 
. : . : . : . : . : . :
rJMFF020G17+ TTGCATTGCACAATGAACTTGTTGTCAGTGAAGCTAGAGATATTTTTCGTTTTCTCGTTT
rJMFF023I02+ TTGCATTGCACAATGAACTTGTTGTCAGTGAAGCTAGAGATATTTTTCGTTTTCTCGTTT
rJMFF009P01+ TTGCATTGCACAATGAACTTGTTGTCAGTGAAGCTAGAGATATTTTTCGTTTTCTCGTTT
rJMFF043H20+ TTGCATTGCACAATGAACTTGTTGTCAGTGAAGCTAGAGATATTTTTCGTTTTCTCGTTT
                      ____________________________________________________________
consensus TTGCATTGCACAATGAACTTGTTGTCAGTGAAGCTAGAGATATTTTTCGTTTTCTCGTTT
 
. : . : . : . : . : . :
rJMFF020G17+ ACTATTTGTTAGAGCCATTCTTTCTTGTATGGGTCAATTTTGTGTATGATTGCTCCTTAG
rJMFF023I02+ ACTATTTGTTAGAGCCATTCTTTCTTGTATGGGTCAATTTTGTGTATGATTGCTCCTTAG
rJMFF009P01+ ACTATTTGTTAGAGCCATTCTTTCTTGTATGGGTCAATTTTGTGTATGATTGCTCCTTAG
rJMFF046L23+ GAGCCATTCTTTCTTGTATGGGTCAATTTTGTGTATGATTGCTCCTTAG
rJMFF043H20+ ACTATTTGTTAGAGCCATTCTTTCTTGTATGGGTCAATTTTGTGTATGATTGCTCCTTAG
                      ____________________________________________________________
consensus ACTATTTGTTAGAGCCATTCTTTCTTGTATGGGTCAATTTTGTGTATGATTGCTCCTTAG
 
. : . : . : . : . : . :
rJMFF020G17+ AGACATATATGAAGTAACTGGAAGATTTTGCCTTCAAAT
rJMFF023I02+ AGACATATATGAAGTAACTGGAAGATTTTGCCTTCAAATT
rJMFF009P01+ AGACATATATGAAGTAACTGGAAGATTTTGCCTTCAAATT
rJMFF046L23+ AGACATATATGAAGTAACTGGAAGATTTTGCCTTCAAATTTCAACTGCTATTTTCTGGAC
rJMFF043H20+ AGACATATATGAAGTAACTGGAAGATTTTGCCTTCAAATTTCAACTGCTATTTTCTGGAC
                      ____________________________________________________________
consensus AGACATATATGAAGTAACTGGAAGATTTTGCCTTCAAATTTCAACTGCTATTTTCTGGAC