Previous Contig 010313:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF006E21Sequence557010313 (17)gb:STU277244_17230241e-65Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).767010313 (17)gb:STU277244_17230244e-52Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFF012J14Sequence482014299gb:STU277244_17230245e-44Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).742010313 (17)gb:STU277244_17230247e-38Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFF013J24Sequence264010313 (17)gb:STU277244_17230245e-22Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFF020I10Sequence515005903 (46)gb:STU277244_17230241e-54Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).731010313 (17)gb:STU277244_17230246e-36Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFF029D06Sequence543005903 (46)gb:STU277244_17230242e-59Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).728010313 (17)gb:STU277244_17230246e-39Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFF033C17Sequence515005903 (46)gb:STU277244_17230249e-54Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).761010313 (17)gb:STU277244_17230241e-42Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFF043H09Sequence647005903 (46)gb:STU277244_17230244e-78Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).560010313 (17)
JMFF050P10Sequence590005903 (46)gb:STU277244_17230241e-60Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).636010313 (17)gb:STU277244_17230249e-11Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFN040J18Sequence490010313 (17)gb:STU277244_17230248e-24Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFS072C02Sequence627010313 (17)gb:STU277244_17230245e-91Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFS159E08Sequence415010313 (17)gb:STU277244_17230242e-35Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMFS163C10Sequence373010313 (17)
JMSF020I07Sequence728005903 (46)gb:STU277244_17230245e-94Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).778010313 (17)gb:STU277244_17230243e-72Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMSF024I16Sequence735005903 (46)gb:STU277244_17230249e-96Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).741010313 (17)gb:STU277244_17230243e-43Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMSF026B19Sequence570005903 (46)gb:STU277244_17230241e-64Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).699010313 (17)gb:STU277244_17230242e-47Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).
JMSF044K08Sequence745005903 (46)gb:STU277244_17230242e-97Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).682010313 (17)gb:STU277244_17230243e-50Solanum tuberosum subsp. tuberosum mRNA for alpha-glucosidase (mal2 gene).

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS072C02- CTCGACAGGAGCTCTATCAGTGGGCGTCAGTTGCTGAATCTGGACGTAATGCTTTGGG
                      ____________________________________________________________
consensus CTCGACAGGAGCTCTATCAGTGGGCGTCAGTTGCTGAATCTGGACGTAATGCTTTGGG
 
. : . : . : . : . : . :
JMFS072C02- TATGAGATATAAGCTTCTTCCATATATTTACACTTTGAACTATGAAGCACATACAACTGG
                      ____________________________________________________________
consensus TATGAGATATAAGCTTCTTCCATATATTTACACTTTGAACTATGAAGCACATACAACTGG
 
. : . : . : . : . : . :
JMFS072C02- GGCACCAATTGCTAGACCACTATTCTTCTCTTTCCCAACTATAACCGAACTATATGGGTT
                      ____________________________________________________________
consensus GGCACCAATTGCTAGACCACTATTCTTCTCTTTCCCAACTATAACCGAACTATATGGGTT
 
. : . : . : . : . : . :
JMFS072C02- GAGCACTCAGTTCTTGCTAGGAAGCAGTGTCATGGTCTCTCCAGTGCTGGAAGCGGGCAA
JMFF006E21- GGCAA
                      ____________________________________________________________
consensus GAGCACTCAGTTCTTGCTAGGAAGCAGTGTCATGGTCTCTCCAGTGCTGGAAGCGGGCAA
 
. : . : . : . : . : . :
JMFS072C02- AACTGAGGTCACAGCTATTTTTCCTCCGGGCACTTGGTACAATCTGTTCGATATGACACA
JMFF006E21- AACTGAGGTCACAGCTATTTTTCCTCCGGGCACTTGGTACAATCTGTTCGATATGACACA
rJMSF020I07+ TCGATATGACACA
                      ____________________________________________________________
consensus AACTGAGGTCACAGCTATTTTTCCTCCGGGCACTTGGTACAATCTGTTCGATATGACACA
 
. : . : . : . : . : . :
JMFS072C02- GGCCATTGTTGCAAAGGAGCCAAAGTCGTTCACACTCGATGCACCTTTGCATGTGATCAA
JMFF006E21- GGCCATTGTTGCAAAGGAGCCAAAGTCGTTCACACTCGATGCACCTTTGCATGTGATCAA
rJMSF020I07+ GGCCATTGTTGCAAAGGAGCCAAAGTCGTTCACACTCGATGCACCTTTGCATGTGATCAA
                      ____________________________________________________________
consensus GGCCATTGTTGCAAAGGAGCCAAAGTCGTTCACACTCGATGCACCTTTGCATGTGATCAA
 
. : . : . : . : . : . :
JMFS072C02- CGTGCATTTGTACCAGAATACCATAATTCCTATGCAACGTGGTGGAGTGAGAACTAAAGA
JMFF006E21- CGTGCATTTGTACCAGAATACCATAATTCCTATGCAACGTGGTGGAGTGAGAACTAAAGA
rJMSF020I07+ CGTGCATTTGTACCAGAATACCATAATTCCTATGCAACGTGGTGGAGTGAGAACTAAAGA
rJMSF044K08+ TATGCAACGTGGTGGAGTGAGAACTAAAGA
rJMFF006E21+ CTATGCAACGTGGTGGAGTGAGAACTAAAGA
                      ____________________________________________________________
consensus CGTGCATTTGTACCAGAATACCATAATTCCTATGCAACGTGGTGGAGTGAGAACTAAAGA
 
. : . : . : . : . : . :
JMFS072C02- AGCACGAGCAA-CCCCATTCAGCCTTATAGTTGCCTT-CCCATTGGGGGCTTCTAGTGCA
JMFF006E21- AGCACGAGCAA-CCCCATTCAGCCTTATAGTTGCCTT-CCCATTGGGGGCTTCTAGTGCA
rJMSF020I07+ AGCACGAGCAA-CCCCATTCAGCCTTATAGTTGCCTT-CCCATTGGGGGCTTCTAGTGCA
rJMSF026B19+ ATAGTTGCCTT-CCCATTGGGGGCTTTTAGTGCA
rJMSF044K08+ AGCACGAGCAACCCCCATTCAGCCTTATAGTTGCCTT-CCCATTGGGGGCTTCTAGTGCA
rJMFF006E21+ AGCACGAGCAA-CCCCATTCAGCCTTATAGTTGCCTTCCCCATTGGGGGCTTCTAGTGCA
rJMSF024I16+ CTAGTGCA
rJMFF012J14+ GTGCA
rJMFF033C17+ TGCA
                      ____________________________________________________________
consensus AGCACGAGCAA-CCCCATTCAGCCTTATAGTTGCCTT-CCCATTGGGGGCTTCTAGTGCA
 
. : . : . : . : . : . :
JMFS072C02- CAAGCCAAAGGAACGCTCTTCCTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
JMFF006E21- CAAGCCAAAGGAACGCTCTTCCTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
rJMSF020I07+ CAAGCCAAAGGAACGCTCTTCCTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
rJMSF026B19+ CAAGCCAAAGGAACGCTCTTCCTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
rJMSF044K08+ CAAGCCAAAGGAACGCTCTTCCTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
rJMFF006E21+ CAAGCCAAAGGAACGCTCTTCCTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
rJMSF024I16+ CAAGCCAAAGGAACGCTCTTCCTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
rJMFF013J24+ GGAAAT
rJMFF012J14+ CAAGCCAAAGGAACGCTCTTCCTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
JMFS159E08- CTTGGAAAT
rJMFF033C17+ CAAGCCAAAGGAACGCTCTTCNTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
rJMFF029D06+ GGATGAGCTCCCTGAAATGAAGCTNGGAAAT
rJMFF020I10+ GAGGATGAGCTCCCTGAAATGAAGCTNGGAAAT
                      ____________________________________________________________
consensus CAAGCCAAAGGAACGCTCTTCCTTGACGAGGATGAGCTCCCTGAAATGAAGCTTGGAAAT
 
. : . : . : . : . : . :
JMFS072C02- GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
JMFF006E21- GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
rJMSF020I07+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
rJMSF026B19+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
rJMSF044K08+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
rJMFF006E21+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
rJMSF024I16+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
rJMFF013J24+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGANCCACTAAGGTATGG
rJMFF012J14+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
JMFS159E08- GGGTACTCAACATGGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
rJMFF033C17+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
rJMFF029D06+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
rJMFF020I10+ GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
                      ____________________________________________________________
consensus GGGTACTCAACATTGGTAAAATTCTATGCAACAGCCAGCAATGGAACCACTAAGGTATGG
 
. : . : . : . : . : . :
JMFS072C02- TCAGATGTTGAGGAAAGCAAGTATGCATTGA
JMFF006E21- TCAGATGTTGAGGAAAGCAATTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMSF020I07+ TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMSF026B19+ TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMSF044K08+ TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMFF006E21+ TCAGATGTTGAGGAAAGCAATTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMSF024I16+ TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMFF013J24+ TCAGATGTTGAGGAAAGCAAGTATGCATNGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMFF012J14+ TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
JMFS159E08- TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMFF033C17+ TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
JMFN040J18- GGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMFF029D06+ TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMFF020I10+ TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
rJMFF050P10+ ATCATAGAGAGAGTAACT
                      ____________________________________________________________
consensus TCAGATGTTGAGGAAAGCAAGTATGCATTGAGTAAAGGGTGGATCATAGAGAGAGTAACT
 
. : . : . : . : . : . :
JMFF006E21- GTACTAGGGTTGAATGCAATTTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
rJMSF020I07+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
rJMSF026B19+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
rJMSF044K08+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
rJMFF006E21+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
rJMSF024I16+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
rJMFF013J24+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAANTGAAGTTGATGGAAGCCCAG
rJMFF012J14+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
JMFS159E08- GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
rJMFF033C17+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
JMFN040J18- GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
rJMFF029D06+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
rJMFF020I10+ GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTTAAAAATTGAAGTTGATGGAAGCCCAG
rJMFF050P10+ GTACTAGGGTGAAATGCAA-TGNGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
                      ____________________________________________________________
consensus GTACTAGGGTTGAATGCAA-TTGGGGGGCAGTTT-AAAATTGAAGTTGATGGAAGCCCAG
 
. : . : . : . : . : . :
JMFF006E21- TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMSF020I07+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMSF026B19+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMSF044K08+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMFF006E21+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMSF024I16+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMFF013J24+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGNACATACATATCCTCAGGCTCAGG
rJMFF012J14+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
JMFS159E08- TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMFF033C17+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
JMFN040J18- TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMFF029D06+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMFF020I10+ TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
rJMFF050P10+ TTGCAGATACTTCCAAGGTGAAG-TTAGCACGACCGGACATACATATCCTCAGGCTCAGG
                      ____________________________________________________________
consensus TTGCAGATACTTCCAAGGTGAAGTTTAGCACGACCGGACATACATATCCTCAGGCTCAGG
 
. : . : . : . : . : . :
JMFF006E21- CACAGGAAAGCGAAG
rJMSF020I07+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
rJMSF026B19+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
rJMSF044K08+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
rJMFF006E21+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
rJMSF024I16+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
rJMFF013J24+ CACAGGAAAGCGAAGGA
rJMFF012J14+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTT-CCTG
JMFS159E08- CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
rJMFF033C17+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
JMFN040J18- CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
rJMFF029D06+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
rJMFF020I10+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
rJMFF050P10+ CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
                      ____________________________________________________________
consensus CACAGGAAAGCGAAGGAGTTAAGAACATGCTGCTTGAGATTAATGGTTTGGAGTTGCCTG
 
. : . : . : . : . : . :
rJMSF020I07+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
rJMSF026B19+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
rJMSF044K08+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
rJMFF006E21+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
rJMSF024I16+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
rJMFF012J14+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
JMFS159E08- TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTANCTTGAAGAGGGCA
rJMFF033C17+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
JMFN040J18- TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
rJMFF029D06+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
rJMFF020I10+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
rJMFF050P10+ TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
                      ____________________________________________________________
consensus TAGGTAAAAACTTTGCCATGTCATGGCATATGGGCATCACTGCTTAGCTTGAAGAGGGCA
 
. : . : . : . : . : . :
rJMSF020I07+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
rJMSF026B19+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
rJMSF044K08+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
rJMFF006E21+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
rJMSF024I16+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
rJMFF012J14+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
JMFS159E08- GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAAC
rJMFF033C17+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
JMFN040J18- GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
rJMFF029D06+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
rJMFF020I10+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
rJMFF050P10+ GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
JMFS163C10+ GGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
rJMFF043H09+ ATTAAAACTAGCTAGCTGGT
                      ____________________________________________________________
consensus GGCTGGCTGGCTATCAAGGCCGGGGCCGGTTTCTGTCTTTATTAAAACTAGCTAGCTTGT
 
. : . : . : . : . : . :
rJMSF020I07+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
rJMSF026B19+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
rJMSF044K08+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
rJMFF006E21+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGTAAATGGCCGGGT
rJMSF024I16+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
rJMFF012J14+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
rJMFF033C17+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
JMFN040J18- ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
rJMFF029D06+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
rJMFF020I10+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
rJMFF050P10+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
JMFS163C10+ ACCAATGTCCCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
rJMFF043H09+ ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
                      ____________________________________________________________
consensus ACCAATGTACCATGCATCATTTCAAGTTTCGATCTGTTACAGGAAAGGAAATGGCCGGGT
 
. : . : . : . : . : . :
rJMSF020I07+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAAC
rJMSF026B19+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
rJMSF044K08+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGG-TTGAGGCCGGTT
rJMFF006E21+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
rJMSF024I16+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
rJMFF012J14+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
rJMFF033C17+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
JMFN040J18- TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
rJMFF029D06+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
rJMFF020I10+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
rJMFF050P10+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
JMFS163C10+ TGAAAATTAAGACGTTCCCAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
rJMFF043H09+ TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
                      ____________________________________________________________
consensus TGAAAATTAAGACGTTCACAGATAGGCAGCAAATTAAACAGGGTTTGAGGCCGGTTTAAG
 
. : . : . : . : . : . :
rJMSF026B19+ ATATAATATATATATATAGTTACCATTTCCATCTTGTGTTGGTTTTGATATCTAGTGTAG
rJMFF006E21+ ATATAATATATATATATAGTTACCATTTCCATCTTGTGTTGGTTTTGATATCTAGTGTAG
rJMSF024I16+ ATATAATATATATATATAGTTACCATTTCCATCTTGTGTTGGTTTTGATATCTAGTGTAG
rJMFF012J14+ ATATAATATATATATATAGTTACCATTTCCATCTTGTGTTGGTTTTGATA--TAGTGTAG
rJMFF033C17+ ATATAATATATATATATAGTTACCATTTCCATCTTGTGTTGGTTTTGATATCTAGTGTAG
JMFN040J18- ATATAATATATATATATAGTTAC
rJMFF029D06+ ATATAATATATATATATAGTTACCATTTCCATCTTGTGTTGGTTTTGATATCTAGTGTAG
rJMFF020I10+ ATATAATATATATATATAGTTACCATTTCCATCTTGTGTTGGTTTTGATATCTAGTGTAG
rJMFF050P10+ ATATAATATATATATATAGTTACCATTTCCATCTTGTGTTGGTTTTGATATCTAGTGTAG
JMFS163C10+ ATATAATATATATATATAGTTCCCATTTCCATCTTGTGTTGGTTTTGATATCTAGGGTAG
rJMFF043H09+ ATATAATATATATATATAGTTCCCATTTCCATCTTGTGTTGGTTTTGATATTTAGTGTAG
                      ____________________________________________________________
consensus ATATAATATATATATATAGTTACCATTTCCATCTTGTGTTGGTTTTGATATCTAGTGTAG
 
. : . : . : . : . : . :
rJMSF026B19+ TC
rJMFF006E21+ TCATGTTGTTTCAACCATA
rJMSF024I16+ TCATGTTGTTTCAACCATAATTTTATTATGCTGTACTTTTGTTGCACTATATGGTCTGAT
rJMFF012J14+ TCATGTTGTTTCAACCATAATTTTATTATGCTGTACTTTTGTTGCACTATATGGTCTGAT
rJMFF033C17+ TCATGTTGTTTCAACCATAATTTTATTATGCTGTACTTTTGTTGCACTATATGGTCTGAT
rJMFF029D06+ TCATGTTGTTTCAACCATAATTTTATTATGCTGTACTTTTGTTGCACTATATGGTCTGAT
rJMFF020I10+ TCATGTTGTTTCAACCATAATTTTATTATGCTGTACTTTTGTTGCACTATATGGTCTGAT
rJMFF050P10+ TCATGTTGTTTCAACCATAATTTTATTATGCTGTACTTTTGTTGCACTATATGGTCTGAT
JMFS163C10+ TCATGTTGTTTCACCCATAATTTTATTATGCTGTACTTTTGTTGCACTATATGGTCTGAT
rJMFF043H09+ TCATGTTGTTTCAACCATAATTTTATTATGCTGTACTTTTGTTGCACTATATGGTTTGAT
                      ____________________________________________________________
consensus TCATGTTGTTTCAACCATAATTTTATTATGCTGTACTTTTGTTGCACTATATGGTCTGAT
 
. : . : . : . : . : . :
rJMSF024I16+ CGATCGAGAC
rJMFF012J14+ CGATCGAGACTGTCAGTAAGTT
rJMFF033C17+ CGATCGAGACTGTCAGTAAGTT
rJMFF029D06+ CGATCGAGACTGTCAGTAAGTT
rJMFF020I10+ CGATCGAGACTGTCAGTAAGTT
rJMFF050P10+ CGATCGAGACTGTCAGTAAGTTTGGAGATGAATAAAAAGGAATGGTAGCACTGC
JMFS163C10+ CGATCGAGACTGTCAGTAAGTTTGGAGATGAATAAAAAGGAATGGTAGCCCTGC
rJMFF043H09+ CGATCGAGACTGTCAGTAAGTTTGGAGATGAATAAAAAGGAATGGTAGCACTGCACAGCT
                      ____________________________________________________________
consensus CGATCGAGACTGTCAGTAAGTTTGGAGATGAATAAAAAGGAATGGTAGCACTGCACAGCT
 
. : . : . : . : . : . :
rJMFF043H09+ AAGTAGCGTGATCGATATATGACTCAAATGGTACACTTTGATTCATCATTTTTTCCATCT
                      ____________________________________________________________
consensus AAGTAGCGTGATCGATATATGACTCAAATGGTACACTTTGATTCATCATTTTTTCCATCT
 
. : . : . : . : . : . :
rJMFF043H09+ CCAATTTCCAATTTCCATTTTCCATTTTCCAGTATGGCAGTATGGTATGGTGAGTGAGAA
                      ____________________________________________________________
consensus CCAATTTCCAATTTCCATTTTCCATTTTCCAGTATGGCAGTATGGTATGGTGAGTGAGAA
 
. : . : . : . : . : . :
rJMFF043H09+ AAGATCAGAAAAAGCATATATACTACTACTGTAATTTTCAGCTTTTACCTCAGTTCGACT
                      ____________________________________________________________
consensus AAGATCAGAAAAAGCATATATACTACTACTGTAATTTTCAGCTTTTACCTCAGTTCGACT
 
. : . : . : . : . : . :
rJMFF043H09+ CTGTACTCTTTATTTCGTXXXXXXXXXXXXXXXXXXXXXXXXXXXGAAAAAAAAAAAAAA
                      ____________________________________________________________
consensus CTGTACTCTTTATTTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAAAAAAAAAAAAA