Previous Contig 010311:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043H01Sequence631010311 (4)sp|P24805|TSJT_TOBAC3e-55Stem-specific protein TSJT1.>pir|S13551|S13551 stem-specific protein - common to647010311 (4)gb:AY045885_15613942e-37Arabidopsis thaliana unknown protein (At4g27450) mRNA, complete cds.>gb:AY087420
JMSF023O01Sequence677010311 (4)sp|P24805|TSJT_TOBAC2e-54Stem-specific protein TSJT1.>pir|S13551|S13551 stem-specific protein - common to722010311 (4)gb:AY045885_15613946e-47Arabidopsis thaliana unknown protein (At4g27450) mRNA, complete cds.>gb:AY087420

Alignment

This contig is upended


. : . : . : . : . : . :
JMSF023O01- GACGGATAAGCATTAATTCTTCATTATATTCAT
                      ____________________________________________________________
consensus GACGGATAAGCATTAATTCTTCATTATATTCAT
 
. : . : . : . : . : . :
JMSF023O01- AGATAAATAGCATATATGTAGCTGCAGTTGGACTGACTCTCTGTATTCTCACTCTGGAAT
JMFF043H01- GTATTCTCACTCTGGAAT
                      ____________________________________________________________
consensus AGATAAATAGCATATATGTAGCTGCAGTTGGACTGACTCTCTGTATTCTCACTCTGGAAT
 
. : . : . : . : . : . :
JMSF023O01- CTTGAAGAAAATGTTGGCTATTTTTGAGCAATCCATTGCCAAGCCACCACCGGAGCTCAG
JMFF043H01- CTTGAAGAAAATGTTGGCTATTTTTGAGCAATCCATTGCCAAGCCACCACCGGAGCTCAG
                      ____________________________________________________________
consensus CTTGAAGAAAATGTTGGCTATTTTTGAGCAATCCATTGCCAAGCCACCACCGGAGCTCAG
 
. : . : . : . : . : . :
JMSF023O01- CCTTCCTTTGGCCGGGCAGCCTGACAAGAAAACCCGGCAAGAAATCGCCGAGATTTTCCG
JMFF043H01- CCTTCCTTTGGCCGGGCAGCCTGACAAGAAAACCCGGCAAGAAATCGCCGAGATTTTCCG
                      ____________________________________________________________
consensus CCTTCCTTTGGCCGGGCAGCCTGACAAGAAAACCCGGCAAGAAATCGCCGAGATTTTCCG
 
. : . : . : . : . : . :
JMSF023O01- GTCACAGAAGCCAGGGGACTCAACTTTGTACAGACTTCCTAATGGGAACTTCTTGGGGGT
JMFF043H01- GTCACAGAAGCCAGGGGACTCAACTTTGTACAGACTTCCTAATGGGAACTTCTTGGGGGT
                      ____________________________________________________________
consensus GTCACAGAAGCCAGGGGACTCAACTTTGTACAGACTTCCTAATGGGAACTTCTTGGGGGT
 
. : . : . : . : . : . :
JMSF023O01- AGGTGGTGAAACCCCATCTCATCCTAGGTCTGTGACTGTGATGGAGGATATATTCTGCAT
JMFF043H01- AGGTGGTGAAACCCCATCTCATCCTAGGTCTGTGACTGTGATGGAGGATATATTCTGCAT
rJMSF023O01+ TCCTAGGTCTGTGACTGTGATGGAGGATATATTCTGCAT
                      ____________________________________________________________
consensus AGGTGGTGAAACCCCATCTCATCCTAGGTCTGTGACTGTGATGGAGGATATATTCTGCAT
 
. : . : . : . : . : . :
JMSF023O01- ATTTTCTGGAGCTCTAGATAATACCTCTGACTTGAGGAAATACTATGGTCTGTCAAGACA
JMFF043H01- ATTTTCTGGAGCTCTAGATAATACCTCTGACTTGAGGAAATACTATGGTCTGTCAAGACA
rJMSF023O01+ ATTTTCTGGAGCTCTAGATAATACCTCTGACTTGAGGAAATACTATGGTCTGTCAAGACA
                      ____________________________________________________________
consensus ATTTTCTGGAGCTCTAGATAATACCTCTGACTTGAGGAAATACTATGGTCTGTCAAGACA
 
. : . : . : . : . : . :
JMSF023O01- GGCCACAGAAGCTATGATCATGGTGGAGGCTTATAAGGTGTTAAGGGACCGCGCGCCATA
JMFF043H01- GGCCACAGAAGCTATGATCATGGTGGAGGCTTATAAGGTGTTAAGGGACCGCGCGCCATA
rJMSF023O01+ GGCCACAGAAGCTATGATCATGGTGGAGGCTTATAAGGTGTTAAGGGACCGCGCGCCATA
rJMFF043H01+ ATGATCATGGTGGAGGCTTATAAGGTGTTAAGGGACCGCGCGCCATA
                      ____________________________________________________________
consensus GGCCACAGAAGCTATGATCATGGTGGAGGCTTATAAGGTGTTAAGGGACCGCGCGCCATA
 
. : . : . : . : . : . :
JMSF023O01- TCCTCCTGATCAGGTCATCAAGGAGCTGCAAGGGAAAATTGCTTTTATCCTCTTTGATTC
JMFF043H01- TCCTCCTGATCAGGTCATCAAGGAGCTGCAAGGGAAATTTGCTTTTATCCTCTTTGATTC
rJMSF023O01+ TCCTCCTGATCAGGTCATCAAGGAGCTGCAAGGGAAAATTGCTTTTATCCTCTTTGATTC
rJMFF043H01+ TCCTCCTGATCAGGTCATCAAGGAGCTGCAAGGGAAATTTGCTTTTATCCTCTTTGATTC
                      ____________________________________________________________
consensus TCCTCCTGATCAGGTCATCAAGGAGCTGCAAGGGAAATTTGCTTTTATCCTCTTTGATTC
 
. : . : . : . : . : . :
JMSF023O01- TAAAGATTCTACTCTTTTTCTAGCCAGGGATCGCGAAGGAAGTGTGGCACTGCACTGGGG
JMFF043H01- TAAAGATTCTACTCTTTTTCTAGCCAGGGATCGCGAAGGAAGTGTGGCACTGCACTGGGG
rJMSF023O01+ TAAAGATTCTACTCTTTTTCTAGCCAGGGATCGCGAAGGAAGTGTGGCACTGCACTGGGG
rJMFF043H01+ TAAAGATTCTACTCTTNTTCTAGCCAGGGATCGCGAAGGAAGTGTGGCACTGCACTGGGG
                      ____________________________________________________________
consensus TAAAGATTCTACTCTTTTTCTAGCCAGGGATCGCGAAGGAAGTGTGGCACTGCACTGGGG
 
. : . : . : . : . : . :
JMSF023O01- AGCCACTGGTGATGGATCATTGATATGTTGTTCTGATGCAGAGCTCATCAAAGCTGCATC
JMFF043H01- AGCCACTGGTGATGGATCATTGATATGTTGTTCTGATGCAGAGCTCATCANAGCTGCATC
rJMSF023O01+ AGCCACTGGTGATGGATCATTGATATGTTGTTCTGATGCAGAGCTCATCAAAGCTGCATC
rJMFF043H01+ AGCCACTGGTGATGGATCATTGATATGTTGTTCTGATGCAGAGCTCATCAAAGCTGCATC
                      ____________________________________________________________
consensus AGCCACTGGTGATGGATCATTGATATGTTGTTCTGATGCAGAGCTCATCAAAGCTGCATC
 
. : . : . : . : . : . :
JMSF023O01- TGGGAAATGTTACACGCCGTTTCCTCCAGGTTGCATTTTCTTGA
JMFF043H01- TGGGAAATGTTACACGCCGTTTCCTCCAGGTTGCATTTTCTTGAGTGAGAGTGGGCTAAC
rJMSF023O01+ TGGGAAATGTTACACGCCGTTTCCTCCAGGTTGCATTTTCTTGAGTGAGAGTGGGCTAAC
rJMFF043H01+ TGGGAAATGTTACACGCCGTTTCCTCCAGGTTGCATTTTCTTGAGTGAGAGTGGGCTAAC
                      ____________________________________________________________
consensus TGGGAAATGTTACACGCCGTTTCCTCCAGGTTGCATTTTCTTGAGTGAGAGTGGGCTAAC
 
. : . : . : . : . : . :
JMFF043H01- CAGCTTTGATCAT
rJMSF023O01+ CAGCTTTGATCATCCACTTCACAAGGTAAAAGCGATGATTCGCGAGGACGATGATGGCAG
rJMFF043H01+ CAGCTTTGATCATCCACTTCACAAGGTAAAAGCGATGATTCGCGAGGACGATGATGGCAG
                      ____________________________________________________________
consensus CAGCTTTGATCATCCACTTCACAAGGTAAAAGCGATGATTCGCGAGGACGATGATGGCAG
 
. : . : . : . : . : . :
rJMSF023O01+ TAATGTGAATGCGATTATTTTCCAAGTCGATTTTTACACCAGACTCCATAGCATTCCGCG
rJMFF043H01+ TAATGTGAATGCGATTATTTTCCAAGTCGATTTTTACACCAGACTCCATAGCATTCCGCG
                      ____________________________________________________________
consensus TAATGTGAATGCGATTATTTTCCAAGTCGATTTTTACACCAGACTCCATAGCATTCCGCG
 
. : . : . : . : . : . :
rJMSF023O01+ GAGAGGAAGTGCATCAAACTGGGCAGGCACAACAGTTGTTGAGGGGGAATAGAGACTAGC
rJMFF043H01+ GAGAGGAAGTGCATCAAACTGGGCAGGCACAACAGTTGTTGAGGGGGAATAGAGACTAGC
                      ____________________________________________________________
consensus GAGAGGAAGTGCATCAAACTGGGCAGGCACAACAGTTGTTGAGGGGGAATAGAGACTAGC
 
. : . : . : . : . : . :
rJMSF023O01+ AAACTTTCCCTTTTTTTGGTGGTAATAAATCAAAGTTTGGTAATAATAATGTGTTATATT
rJMFF043H01+ AAACTTTCCCTTTTTTTGGTGGTAATAAATCAAAGTTTGGTAATAATAATGTGTTATATT
                      ____________________________________________________________
consensus AAACTTTCCCTTTTTTTGGTGGTAATAAATCAAAGTTTGGTAATAATAATGTGTTATATT
 
. : . : . : . : . : . :
rJMSF023O01+ GTAAATGATGCTTGAATCTCATTCAACATCACACTTGTGTTAATGTTTTCTCTTTAATCT
rJMFF043H01+ GTAAATGATGCTTGAATCTCATTCAACATCACACTTGTGTTAATGTTTTCTCTTTAATCT
                      ____________________________________________________________
consensus GTAAATGATGCTTGAATCTCATTCAACATCACACTTGTGTTAATGTTTTCTCTTTAATCT
 
. : . : . : . : . : . :
rJMSF023O01+ GTACAACTTTTTGATGCACAAA
rJMFF043H01+ GTACAACTTTTTGATGCACAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus GTACAACTTTTTGATGCACAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG