Previous Contig 010308:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF028B01Sequence552010308 (14)gb:AP005895_18597958e-51Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN615010308 (14)gb:AY087173_15722073e-29Arabidopsis thaliana clone 32443 mRNA, complete sequence.
JMFF041L02Sequence646010308 (14)gb:AY087173_15722073e-56Arabidopsis thaliana clone 32443 mRNA, complete sequence.603010308 (14)gb:AY087173_15722073e-29Arabidopsis thaliana clone 32443 mRNA, complete sequence.
JMFF043G10Sequence634010308 (14)gb:AY087173_15722071e-54Arabidopsis thaliana clone 32443 mRNA, complete sequence.630010308 (14)gb:BT015937_16425553e-28Arabidopsis thaliana At5g20510 mRNA, complete cds.>gb:BT020505_1642899 Arabidops
JMFF046E18Sequence626010308 (14)gb:AP005895_18597951e-44Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN612010308 (14)gb:AY087173_15722075e-31Arabidopsis thaliana clone 32443 mRNA, complete sequence.
JMFF046L15Sequence583010308 (14)gb:AP005895_18597955e-38Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN439010308 (14)gb:BT015937_16425554e-25Arabidopsis thaliana At5g20510 mRNA, complete cds.>gb:BT020505_1642899 Arabidops
JMSF004O11Sequence188010308 (14)222010308 (14)
JMSF020K24Sequence671010308 (14)gb:AP005895_18597957e-54Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJN750010308 (14)gb:AY087173_15722071e-62Arabidopsis thaliana clone 32443 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF046E18- AGATTCAAATCCG
JMSF020K24- GGAGATTCAAATCCG
                      ____________________________________________________________
consensus GGAGATTCAAATCCG
 
. : . : . : . : . : . :
JMSF004O11- CTTGCAGAAGTAGCAGCAAGTTTTCAGCGGATTGT
JMFF046E18- CCCCATTCTTCTTTCTCTCTCTAGACTTGCAGAAGTAGCAGCAAGTTTTCAGCGGATTGT
JMFF046L15- CTTGCAGAAGTAGCAGCAAGTTTTCAGCGGATTGT
JMSF020K24- CCCCATTCTTCTTTCTCTCTCTAGACTTGCAGAAGTAGCAGCAAGTTTTCAGCGGATTGT
                      ____________________________________________________________
consensus CCCCATTCTTCTTTCTCTCTCTAGACTTGCAGAAGTAGCAGCAAGTTTTCAGCGGATTGT
 
. : . : . : . : . : . :
JMSF004O11- CTTACCCAAATAACAAAACCTTCTAATATCCACTTCCCTTCCTATTTTTATCCCTACTCT
JMFF046E18- CTTACCCAAATAACAAAACCTTCTAATATCCACTTCCCTTCCTATTTTTATCCCTACTCT
JMFF046L15- CTTACCCAAATAACAAAACCTTCTAATATCCACTTCCCTTCCTATTTTTATCCCTACTCT
JMSF020K24- CTTACCCAAATAACAAAACCTTCTAATATCCACTTCCCTTCCTATTTTTATCCCTACTCT
JMFF028B01- ACTCT
JMFF043G10- ACTCT
JMFF041L02- ACTCT
                      ____________________________________________________________
consensus CTTACCCAAATAACAAAACCTTCTAATATCCACTTCCCTTCCTATTTTTATCCCTACTCT
 
. : . : . : . : . : . :
JMSF004O11- ACTATTTCTGTACAGAATTTTGTTTCTTGAAGCTTCGTAAGTAAGCAGCTGAGCTTAGCT
JMFF046E18- ACTATTTCTGTACAGAATTTTGTTTCTTGAAGCTTCGTAAGTAAGCAGCTGAGCTTAGCT
JMFF046L15- ACTATTTCTGTACAGAATTTTGTTTCTTGAAGCTTCGTAAGTAAGCAGCTGAGCTTAGCT
JMSF020K24- ACTATTTCTGTACAGAATTTTGTTTCTTGAAGCTTCGTAAGTAAGCAGCTGAGCTTAGCT
JMFF028B01- ACTATTTCTGTACAGAATTTTGTTTCTTGAAGCTTCGTAAGTAAGCAGCTGAGCTTAGCT
JMFF043G10- ACTATTTCTGTACAGAATTTTGTTTCTTGAAGCTTCGTAAGTAAGCAGCTGAGCTTAGCT
JMFF041L02- ACTATTTCTGTACAGAATTTTGTTTCTTGAAGCTTCGTAAGTAAGCAGCTGAGCTTAGCT
                      ____________________________________________________________
consensus ACTATTTCTGTACAGAATTTTGTTTCTTGAAGCTTCGTAAGTAAGCAGCTGAGCTTAGCT
 
. : . : . : . : . : . :
JMSF004O11- GGAGAAATGGAGGGAGCGGTTGGCGTA
JMFF046E18- GGAGAAATGGAGGGAGCGGTTGGCGTAGGAGGAGGAGGAGTAGCCGCCGCCGGCGTAGGC
JMFF046L15- GGAGAAATGGAGGGAGCGGTTGGCGTAGGAGGAGGAGGAGTAGCCGCCGCCGGCGTAGGC
JMSF020K24- GGAGAAATGGAGGGAGCGGTTGGCGTAGGAGGAGGAGGAGTAGCCGCCGCCGGCGTAGGC
JMFF028B01- GGAGAAATGGAGGGAGCGGTTGGCGTAGGAGGAGGAGGAGTAGCCGCCGCCGGCGTAGGC
JMFF043G10- GGAGAAATGGAGGGAGCGGTTGGCGTAGGAGGAGGAGGAGTAGCCGCCGCCGGCGTAGGC
JMFF041L02- GGAGAAATGGAGGGAGCGGTTGGCGTAGGAGGAGGAGGAGTAGCCGCCGCCGGCGTAGGC
                      ____________________________________________________________
consensus GGAGAAATGGAGGGAGCGGTTGGCGTAGGAGGAGGAGGAGTAGCCGCCGCCGGCGTAGGC
 
. : . : . : . : . : . :
JMFF046E18- GGAGGCGGACAGTACAACCCTCGTACTGTTGAGGAAGTCTTTAAGGATTTCAAGGGTCGC
JMFF046L15- GGAGGCGGACAGTACAACCCTCGTACTGTTGAGGAAGTCTTTAAGGATTTCAAGGGTCGC
JMSF020K24- GGAGGCGGACAGTACAACCCTCGTACTGTTGAGGAAGTCTTTAAGGATTTCAAGGGTCGC
JMFF028B01- GGAGGCGGACAGTACAACCCTCGTACTGTTGAGGAAGTCTTTAAGGATTTCAAGGGTCGC
JMFF043G10- GGAGGCGGACAGTACAACCCTCGTACTGTTGAGGAAGTCTTTAAGGATTTCAAGGGTCGC
JMFF041L02- GGAGGCGGACAGTACAACCCTCGTACTGTTGAGGAAGTCTTTAAGGATTTCAAGGGTCGC
                      ____________________________________________________________
consensus GGAGGCGGACAGTACAACCCTCGTACTGTTGAGGAAGTCTTTAAGGATTTCAAGGGTCGC
 
. : . : . : . : . : . :
JMFF046E18- CGGGACGGCTTAATTAAAGCCCTCACTACAGATGTCAATGATTTTTATCAGCAGTGTGAC
JMFF046L15- CGGAACGGCTTAATTAAAGCCCTCACTACAGATGTCAATGATTTTTATCAGCAGTGTGAC
JMSF020K24- CGGAACGGCTTAATTAAAGCCCTCACTACAGATGTCAATGATTTTTATCAGCAGTGTGAC
JMFF028B01- CGGAACGGCTTAATTAAAGCCCTCACTACAGATGTCAATGATTTTTATCAGCAGTGTGAC
JMFF043G10- CGGAACGGCTTAATTAAAGCCCTCACTACAGATGTCAATGATTTTTATCAGCAGTGTGAC
JMFF041L02- CGGAACGGCTTAATTAAAGCCCTCACTACAGATGTCAATGATTTTTATCAGCAGTGTGAC
                      ____________________________________________________________
consensus CGGAACGGCTTAATTAAAGCCCTCACTACAGATGTCAATGATTTTTATCAGCAGTGTGAC
 
. : . : . : . : . : . :
JMFF046E18- CCAGAGAAGGAGAACTTGTGCTTGTATGGGTTTCCCAGTGAGCAGTGGGAGGTCAACTTG
JMFF046L15- CCAGAGAAGGAGAACTTGTGCTTGTATGGGTTTCCCAGTGAGCAGTGGGAGGTCAACTTG
JMSF020K24- CCAGAGAAGGAGAACTTGTGCTTGTATGGGTTTCCCAGTGAGCAGTGGGAGGTCAACTTG
JMFF028B01- CCAGAGAAGGAGAACTTGTGCTTGTATGGGTTTCCCAGTGAGCAGTGGGAGGTCAACTTG
JMFF043G10- CCAGAGAAGGAGAACTTGTGCTTGTATGGGTTTCCCAGTGAGCAGTGGGAGGTCAACTTG
JMFF041L02- CCAGAGAAGGAGAACTTGTGCTTGTATGGGTTTCCCAGTGAGCAGTGGGAGGTCAACTTG
                      ____________________________________________________________
consensus CCAGAGAAGGAGAACTTGTGCTTGTATGGGTTTCCCAGTGAGCAGTGGGAGGTCAACTTG
 
. : . : . : . : . : . :
JMFF046E18- CCTGCGGAAGAAGTGCCTCCGGAGCTTCCAGAGCCCGCTCTCGGGATTAACTTTGCGAGA
JMFF046L15- CCTGCGGAAGAAGTGCCTCCGGAGCTTCCAGAGCCCGCTCTCGGGATTAACTTTGCGAGA
JMSF020K24- CCTGCGGAAGAAGTGCCTCCGGAGCTTCCAGAGCCCGCTCTCGGGATTAACTTTGCGAGA
JMFF028B01- CCTGCGGAAGAAGTGCCTCCGGAGCTTCCAGAGCCCGCTCTCGGGATTAACTTTGCGAGA
JMFF043G10- CCTGCGGAAGAAGTGCCTCCGGAGCTTCCAGAGCCCGCTCTCGGGATTAACTTTGCGAGA
JMFF041L02- CCTGCGGAAGAAGTGCCTCCGGAGCTTCCAGAGCCCGCTCTCGGGATTAACTTTGCGAGA
rJMSF020K24+ CTTTGCGAGA
                      ____________________________________________________________
consensus CCTGCGGAAGAAGTGCCTCCGGAGCTTCCAGAGCCCGCTCTCGGGATTAACTTTGCGAGA
 
. : . : . : . : . : . :
JMFF046E18- GATGGGATGCAGGAAAAGGACTGGTTGTCTTTAGTTGCTGTCCACAGCGATGCTTGGTTG
JMFF046L15- GATGGGATGCAGGAAAAGGACTGGTTGTCTTTAGTTGCTGTCCACAGCGATGCTTGGTTG
JMSF020K24- GATGGGATGCAGGAAAAGGACTGGTTGTCTTTAGTTGCTGTCCACAGCGATGCTTGGTTG
JMFF028B01- GATGGGATGCAGGAAAAGGACTGGTTGTCTTTAGTTGCTGTCCACAGCGATGCTTGGTTG
JMFF043G10- GATGGGATGCAGGAAAAGGACTGGTTGTCTTTAGTTGCTGTCCACAGCGATGCTTGGTTG
JMFF041L02- GATGGGATGCAGGAAAAGGACTGGTTGTCTTTAGTTGCTGTCCACAGCGATGCTTGGTTG
rJMSF020K24+ GATGGGATGCAGGAAAAGGACTGGTTGTCTTTAGTTGCTGTCCACAGCGATGCTTGGTTG
                      ____________________________________________________________
consensus GATGGGATGCAGGAAAAGGACTGGTTGTCTTTAGTTGCTGTCCACAGCGATGCTTGGTTG
 
. : . : . : . : . : . :
JMFF046E18- CTTGCCGTGGCGTTCTATTTCGGTTCCAGATTTGNGATTGATAAAGCTGACAGGAAACGA
JMFF046L15- CTTTGCGTGGCGTTCTA-TTCGGGTCCAGATTTGGNATTGAT-AAGCTGACAGG-AACGA
JMSF020K24- CTTGCCGTGGCGTTCTATTTCGGTTCCAGATTTGGATTTGATAAAGCTGACAGGAAACGA
JMFF028B01- CTTGCCGTGGCGTTCTATTTCGGTTCCAGATTTGGATTTGATAAAGCTGACAGGAAACGA
JMFF043G10- CTTGCCGTGGCGTTCTATTTCGGTTCCAGATTTGGATTTGATAAAGCTGACAGGAAACGA
JMFF041L02- CTTGCCGTGGCGTTCTATTTCGGTTCCAGATTTGGATTTGATAAAGCTGACAGGAAACGA
rJMSF020K24+ CTTGCCGTGGCGTTCTATTTCGGTTCCAGATTTGGATTTGATAAAGCTGACAGGAAACGA
                      ____________________________________________________________
consensus CTTGCCGTGGCGTTCTATTTCGGTTCCAGATTTGGATTTGATAAAGCTGACAGGAAACGA
 
. : . : . : . : . : . :
JMFF046E18- CTC
JMFF046L15- CTCTTCA
JMSF020K24- CTCTTCAACATGATAAACGATATGCCTACA-GTATTTGAAGTTGTGACGGGCGCTGC
JMFF028B01- CTCTTCAACATGATAAACGATATGCCTACAGGTATTTGAAGTTGTGACGGGCGCTGCAAA
JMFF043G10- CTCTTCAACATGATAAACGATATGCCTACA-GTATTTGAAGTTGTGACGGGCGCTGCAAA
JMFF041L02- CTCTTCAACATGATAAACGATATGCCTACA-GTATTTGAAGTTGTGACGGGCGCTGCAAA
rJMSF020K24+ CTCTTCAACATGATAAACGATATGCCTACA-GTATTTGAAGTTGTGACGGGCGCTGCAAA
                      ____________________________________________________________
consensus CTCTTCAACATGATAAACGATATGCCTACA-GTATTTGAAGTTGTGACGGGCGCTGCAAA
 
. : . : . : . : . : . :
JMFF028B01- GAAACAG
JMFF043G10- GAAACAGCAGAAGGAGAAATCTTCCGTCTCGAATCACAGTAGCAACAAATCANAGTCAAA
JMFF041L02- GAAACAGCAGAAGGAGAAATCTTCCGTCTCGAATCACAGTAGCAACAAATCAAAGTCAAA
rJMSF020K24+ GAAACAGCAGAAGGAGAAGTCTTCCGTCTCGAATCACAGTAGCAACAAATCAAAGTCAAA
rJMFF028B01+ TCACAGTAGCAACAAATCAAAGTCAAA
rJMFF046E18+ GTAGCAACAAATCAAAGTCAAA
                      ____________________________________________________________
consensus GAAACAGCAGAAGGAGAAATCTTCCGTCTCGAATCACAGTAGCAACAAATCAAAGTCAAA
 
. : . : . : . : . : . :
JMFF043G10- TCCTANACCGCAGCGGGCATCTGAATCTCA
JMFF041L02- TCCTAAACCGCAGCGGGCATCTGAATCTCAGGGAAGGTACAC
rJMSF020K24+ TCCTAAACCGCAGCGGGCATCTGAATCTCAGGGAAGGTACACAAAACCGCCAACCAAAGA
rJMFF028B01+ TCCTAAACCGCAGCGGGCATCTGAATCTCAGGGAAGGTACACAAAACCGCCAACCAAAGA
rJMFF046E18+ TCTTAAACCGCAGCGGGCATCTGAATCTCAGGGAAGGTACACAAAACCGCCAACCAAAGA
rJMFF041L02+ CAGCGGGCATCTGAATCTCAGGGAAGGTACACAAAACCGCCAACCAAAGA
rJMFF043G10+ CAGGGAAGGTACACAAAACCGCCAACCAAAGA
                      ____________________________________________________________
consensus TCCTAAACCGCAGCGGGCATCTGAATCTCAGGGAAGGTACACAAAACCGCCAACCAAAGA
 
. : . : . : . : . : . :
rJMSF020K24+ CGAAGAGGAGGGGGGATTGGAGGAGGAAGACGAGGAGGAAGAGGAGCATGGCGAGACCTT
rJMFF028B01+ CGAAGAGGAGGGGGGATTGGAGGAGGAAGACGAGGAGGAAGAGGAGCATGGCGAGACCTT
rJMFF046E18+ CGAAGAGGAGGGGGGATTGGAGGAGGAAGACGAGGAGGAAGAGGAGCATGGCGAGACCTT
rJMFF041L02+ CGAAGAGGAGGGGGGATTGGAGGAGGAAGACGAGGAGGAAGAGGAGCATGGCGAGACCTT
rJMFF043G10+ CGAAGAGGAGGGGGGATTGGAGGAGGAAGACGAGGAGGAAGAGGAGCATGGCGAGACCTT
                      ____________________________________________________________
consensus CGAAGAGGAGGGGGGATTGGAGGAGGAAGACGAGGAGGAAGAGGAGCATGGCGAGACCTT
 
. : . : . : . : . : . :
rJMSF020K24+ GTGTGGGGCTTGCGGGGAGAACTATGCATCGGATGAGTTTTGGATATGCTGTGACATACG
rJMFF046L15+ TGGAGCTTGCGGGGAGAACTATGCATCGGATGAGTTTNGGATATGCTGTGACATATG
rJMFF028B01+ GTGTGGAGCTTGCGGGGAGAACTATGCATCGGATGAGTTTTGGATATGCTGTGACATATG
rJMFF046E18+ GTGTGGAGCTTGCGGGGAGAACTATGCATCGGATGAGTTTTGGATATGCTGTGACATATG
rJMFF041L02+ GTGTGGAGCTTGCGGGGAGAACTATGCATCGGATGAGTTTTGGATATGCTGTGACATATG
rJMFF043G10+ GTGTGGAGCTTGCGGGGAGAACTATGCATCGGATGAGTTTTGGATATGCTGTGACATATG
                      ____________________________________________________________
consensus GTGTGGAGCTTGCGGGGAGAACTATGCATCGGATGAGTTTTGGATATGCTGTGACATATG
 
. : . : . : . : . : . :
rJMSF020K24+ CGAGAAGTGGTTCCATGGCAAGTGTGTGAAAATCACCCCCGCCAGAGCCGAACACATCAA
rJMFF046L15+ CGAGAAGTGGTTCCATGGCAAGTGTGTGAAAATCACCCCCGCCAGAGCCGAACACATCAA
rJMFF028B01+ CGAGAAGTGGTTCCATGGCAAGTGTGTGAAAATCACCCCCGCCAGAGCCGAACACATCAA
rJMFF046E18+ CGAGAAGTGGTTCCATGGCAAGTGTGTGAAAATCACCCCCGCCAGAGCCGAACACATCAA
rJMFF041L02+ CGAGAAGTGGTTCCATGGCAAGTGTGTGAAAATCACCCCCGCCAGAGCCGAACACATCAA
rJMFF043G10+ CGAGAAGTGGTTCCATGGCAAGTGTGTGAAAATCACCCCCGCCAGAGCCGAACACATCAA
                      ____________________________________________________________
consensus CGAGAAGTGGTTCCATGGCAAGTGTGTGAAAATCACCCCCGCCAGAGCCGAACACATCAA
 
. : . : . : . : . : . :
rJMSF020K24+ GCAATACAAGTGCCCGTCTTGCAGCAACAAGAGAGCTCGCCCTTGATGATGATGTAGAAA
rJMFF046L15+ GCAATACAAGTGCCCGTCTTGCAGCAACAAGAGAGCTCGCCCTTGATGATGATGTAGAAA
rJMSF004O11+ CCTTGATGATGATGTAGAAA
rJMFF028B01+ GCAATACAAGTGCCCGTCTTGCAGCAACAAGAGAGCTCGCCCTTGATGATGATGTAGAAA
rJMFF046E18+ GCAATACAAGTGCCCGTCTTGCAGCAACAAGAGAGCTCGCCCTTGATGATGATGTAGAAA
rJMFF041L02+ GCAATACAAGTGCCCGTCTTGCAGCAACAAGAGAGCTCGCCCTTGATGATGATGTAGAAA
rJMFF043G10+ GCAATACAAGTGCCCGTCTTGCAGCAACAAGAGAGCTCGCCCTTGATGATGATGTAGAAA
                      ____________________________________________________________
consensus GCAATACAAGTGCCCGTCTTGCAGCAACAAGAGAGCTCGCCCTTGATGATGATGTAGAAA
 
. : . : . : . : . : . :
rJMSF020K24+ ACCATTTTTATTTCGATAGACAACACTGGATGATGATGGTGATTATGATGCTGTGTCAAT
rJMFF046L15+ ACCATTTTTATTTCGATAGACAACACTGGATGATGATGGTGATTATGATGCTGTGTCAAT
rJMSF004O11+ ACCATTTNTANTTCGATAGACAACACTGGATGATGATGGTGATTATGATNCTGTGTCAAT
rJMFF028B01+ ACCATTTTTATTTCGATAGACAACACTGGATGATGATGGTGATTATGATGCTGTGTCAAT
rJMFF046E18+ ACCATTTTTATTTCGATAGACAACACTGGATGATGATGGTGATTATGATGCTGTGTCAAT
rJMFF041L02+ ACCATTTTTATTTCGATAGACAACACTGGATGATGATGGTGATTATGATGCTGTGTCAAT
rJMFF043G10+ ACCATTTTTATTTCGATAGACAACACTGGATGATGATGGTGATTATGATGCTGTGTCAAT
                      ____________________________________________________________
consensus ACCATTTTTATTTCGATAGACAACACTGGATGATGATGGTGATTATGATGCTGTGTCAAT
 
. : . : . : . : . : . :
rJMSF020K24+ CAGTTTCTTTGTATTAGTCATGCACGTTAGCCTAATTGTGGATGTACCTTTGTAGTGTAG
rJMFF046L15+ CAGTTTCTTTGTATTAGTCATGCACGTTAGCCTAATTGTGGATGTACCTTTGTAGTGTAG
rJMSF004O11+ CAGNTTCTTTGTATTAGTCATGCACGTTAGCCTAATTGTGGATGTACCTTTGTAGTGTAG
rJMFF028B01+ CAGTTTCTTTGTATTAGTCATGCACGTTAGCCTAATTGTGGATGTACCTTTGTAGTGTAG
rJMFF046E18+ CAGTTTCTTTGTATTAGTCATGCACGTTAGCCTAATTGTGGATGTACCTTTGTAGTGTAG
rJMFF041L02+ CAGTTTCTTTGTATTAGTCATGCACGTTAGCCTAATTGTGGATGTACCTTTGTAGTGTAG
rJMFF043G10+ CAGTTTCTTTGTATTAGTCATGCACGTTAGCCTAATTGTGGATGTACCTTTGTAGTGTAG
                      ____________________________________________________________
consensus CAGTTTCTTTGTATTAGTCATGCACGTTAGCCTAATTGTGGATGTACCTTTGTAGTGTAG
 
. : . : . : . : . : . :
rJMSF020K24+ CAGAACTAGTTTTCATTTTCGAACATTCTTTAGAATTTTAGCCTTCATTTTA-CTGCTAG
rJMFF046L15+ CAGAACTAGTTTTCATTTTCGAACATTCTTTAGAATTTTAGCCTTCATTTTA-CTGCTAG
rJMSF004O11+ CAGAACTAGTTTTCATTTTCGAACATTCTTTAGAATTNTAGCCNTCATTTTAGCTGCTAG
rJMFF028B01+ CAGAACTAGTTTTCATTTTCGAACATTCTTTAGAATTTTAGCCTTCATTTTA-CTGCTAG
rJMFF046E18+ CAGAACTAGTTTTCATTTTCGAACATTCTTTAGAATTTTAGCCTTCATTTTA-CTGCTAG
rJMFF041L02+ CAGAACTAGTTTTCATTTTCGAACATTCTTTAGAATTTTAGCCTTCATTTTA-CTGCTAG
rJMFF043G10+ CAGAACTAGTTTTCATTTTCGAACATTCTTTAGAATTTTAGCCTTCATTTTA-CTGCTAG
                      ____________________________________________________________
consensus CAGAACTAGTTTTCATTTTCGAACATTCTTTAGAATTTTAGCCTTCATTTTA-CTGCTAG
 
. : . : . : . : . : . :
rJMSF020K24+ TGTATCATTATTGTGACAAGTT
rJMFF046L15+ TGTATCATTATTGTGACAAGTTTCAAGTTTCTCCTGAAAGATGAAGTTCTGTGG
rJMSF004O11+ TGTATCATTATTGTGACAAGTT
rJMFF028B01+ TGTATCATTATTGTGACAAGTTTCAAGTTTCTCCTGAAAGATGAAGTTCTGTGGAGATTG
rJMFF046E18+ TGTATCATTATTGTGACAAGTTTCAAGTTTCTCCTGAAAGATGAAGTTCTGTGGAGATTG
rJMFF041L02+ TGTATCATTATTGTGACAAGTTTCAAGTTTCTCCTGAAAGATGAAGTTCTGTGGAGATTG
rJMFF043G10+ TGTATCATTATTGTGACAAGTTTCAAGTTTCTCCTGAAAGATGAAGTTCTGTGGAGATTG
                      ____________________________________________________________
consensus TGTATCATTATTGTGACAAGTTTCAAGTTTCTCCTGAAAGATGAAGTTCTGTGGAGATTG
 
. : . : . : . : . : . :
rJMFF028B01+ TGTTACTTCTAA
rJMFF046E18+ TGTTACTTCTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
rJMFF041L02+ TGTTACTTCT-AAGTTGATTCCACTTCTATCCTTGGCAACTAACTACTTTTATTTGATTC
rJMFF043G10+ TGTTACTTCT-AAGTTGATTCCACTTCTATCCTTGGCAACTAACTACTTTTATTTGATTC
                      ____________________________________________________________
consensus TGTTACTTCTAAAGTTGATTCCACTTCTATCCTTGGCAACTAACTACTTTTATTTGATTC
 
. : . : . : . : . : . :
rJMFF041L02+ AAATGTGCGTTTTGG
rJMFF043G10+ AAATGTGCGTTTTGGGTGGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus AAATGTGCGTTTTGGGTGGAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG