Previous Contig 010306:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF015L13Sequence621010306 (5)pir|T05953|T059536e-60polyphosphoinositide binding protein Ssh2 - soybean>gb:AF024652_1762140 Glycine 654010306 (5)gb:AY080700_15684232e-61Arabidopsis thaliana putative polyphosphoinositide binding protein (At1g01630) m
JMFF043G02Sequence618001846 (2)pir|G84831|G848318e-27probable bZIP transcription factor [imported] - Arabidopsis thaliana>gb:AC002336633010306 (5)gb:AY080700_15684235e-54Arabidopsis thaliana putative polyphosphoinositide binding protein (At1g01630) m
JMSF009L07Sequence343010306 (5)pir|T05953|T059534e-20polyphosphoinositide binding protein Ssh2 - soybean>gb:AF024652_1762140 Glycine 806010306 (5)pir|T05953|T059536e-86polyphosphoinositide binding protein Ssh2 - soybean>gb:AF024652_1762140 Glycine

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF015L13- AATACAGAACA
                      ____________________________________________________________
consensus AATACAGAACA
 
. : . : . : . : . : . :
JMSF009L07- GAACAGATACTCTCTTCTCCACCTCAGTTTCTGATCTTCCATTTTCAAAAGAAAATTGGC
JMFF015L13- GAACAGATACTCTCTTCTCCACCTCAGTTTCTGATCTTCCATTTTCAAAAGAAAATTGGC
rJMSF009L07+ TCAAAAGAAAATNGGC
                      ____________________________________________________________
consensus GAACAGATACTCTCTTCTCCACCTCAGTTTCTGATCTTCCATTTTCAAAAGAAAATTGGC
 
. : . : . : . : . : . :
JMSF009L07- AGTGATGGAGGAGAATATGGGAATTGGGGAAAATAATGGGCAGAAAGTGAAAGACGCAGA
JMFF015L13- AGTGATGGAGGAGAATATGGGAATTGGGGAAAATAATGGGCAGAAAGTGGAAGACGCAGA
rJMSF009L07+ AGTGA-NGAGGAGGATATNGGAATTGGGGAAAATAATGGGCAGAAAGTGAAAGACGCAGA
                      ____________________________________________________________
consensus AGTGATGGAGGAGAATATGGGAATTGGGGAAAATAATGGGCAGAAAGTGAAAGACGCAGA
 
. : . : . : . : . : . :
JMSF009L07- AAGCTTTAGCCTTCAAGAGAGGAACAAAGTTGAGCTGATGAGAGCTGTTGTGCAGAAACA
JMFF015L13- AAGCTTTAGCCTTCAAGAGAGGAACAAAGTTGAGCTGATGAGAGCTGTTGTGCAGAAACA
rJMSF009L07+ AAGCTTTAGCCTTCAAGAGAGGAACAAAGTTGAGCTGATGAGAGCTGTTGTGCAGAAACA
                      ____________________________________________________________
consensus AAGCTTTAGCCTTCAAGAGAGGAACAAAGTTGAGCTGATGAGAGCTGTTGTGCAGAAACA
 
. : . : . : . : . : . :
JMSF009L07- AGATCCATCTTCTCAGGAAGTTGACGATTACGCAATGAGAAGATTTCTTCGTGCACGTGA
JMFF015L13- AGATCCATCTTCTCAGGAAGTTGACGATTACGCAATGAGAAGATTTCTTCGTGCACGTGA
rJMSF009L07+ AGATCCATCTTCTCAGGAAGTTGACGATTACGCAATGAGAAGATTTCTTCGTGCACGTGA
                      ____________________________________________________________
consensus AGATCCATCTTCTCAGGAAGTTGACGATTACGCAATGAGAAGATTTCTTCGTGCACGTGA
 
. : . : . : . : . : . :
JMSF009L07- TCTAGACATTGAAAAAGCTTCTGCCATGTTGTTAAAGTATCTCAAATGGAAGCGTACATT
JMFF015L13- TCTAGACATTGAAAAAGCTTCTGCCATGTTGTTAAAGTATCTCAAATGGAAGCGTACATT
rJMSF009L07+ TCTAGACATTGAAAAAGCTTCTGCCATGTTGTTAAAGTATCTCAAATGGAAGCGTACATT
                      ____________________________________________________________
consensus TCTAGACATTGAAAAAGCTTCTGCCATGTTGTTAAAGTATCTCAAATGGAAGCGTACATT
 
. : . : . : . : . : . :
JMSF009L07- TATGCCAAAAGGTTGTATTTCAACCTCAGAAATACAAAA
JMFF015L13- TATGCCAAAAGGTTGTATTTCAACCTCAGAAATACAAAATGAAATAGCCCAAAACAAGAT
rJMSF009L07+ TATGCCAAAAGGTTGTATTTCAACCTCAGAAATACAAAAGGAAATAGCCCAAAACAAGAT
rJMFF015L13+ CTCAGAAATACAAAATGAAATAGCCCAAAACAAGAT
                      ____________________________________________________________
consensus TATGCCAAAAGGTTGTATTTCAACCTCAGAAATACAAAATGAAATAGCCCAAAACAAGAT
 
. : . : . : . : . : . :
JMFF015L13- GTTTATGCAAGGAGTGGATAAACAAGGACGTCCCATTGCGGTTGTTTATGGTGGTAGACA
rJMSF009L07+ GTTTATGCAAGGAGTGGATAAACAAGGACGTCCCATTGCGGTTGTTTATGGTGGTAGACA
rJMFF015L13+ GTTTATGCAAGGAGTGGATAAACAAGGACGTCCCATTGCGGTTGTTTATGGTGGTAGACA
rJMFF043G02+ ACGTCCCATTGCGGTTGTTTATGGTGGTAGACA
                      ____________________________________________________________
consensus GTTTATGCAAGGAGTGGATAAACAAGGACGTCCCATTGCGGTTGTTTATGGTGGTAGACA
 
. : . : . : . : . : . :
JMFF015L13- TCTACAAAACAAAGGTGGACTCGAAGAATTTAAACGTTATGTAGCTTTTGGTTTGGACAA
rJMSF009L07+ TCTACAAAACAAAGGTGGACTCGAAGAATTTAAACGTTATGTAGCTTTTGGTTTGGACAA
rJMFF015L13+ TCTACAAAACAAAGGTGGACTCGAAGAATTTAAACGTTATGTAGCTTTTGGTTTGGACAA
rJMFF043G02+ TCTACAAAACAAAGGTGGACTCGAAGAATTTAAACGTTATGTAGCTTTTGGTTTGGACAA
                      ____________________________________________________________
consensus TCTACAAAACAAAGGTGGACTCGAAGAATTTAAACGTTATGTAGCTTTTGGTTTGGACAA
 
. : . : . : . : . : . :
JMFF015L13- ATTATGTGCAAGGACATCACCTGGCAAGGAGAAGTTTGTTGTGATTGGAGATCTTGAAGG
rJMSF009L07+ ATTATGTGCAAGGACATCACCTGGCAAGGAGAAGTTTGTTGTGATTGGAGATCTTGAAGG
rJMFF015L13+ ATTATGTGCAAGGACATCACCTGGCAAGGAGAAGTTTGTTGTGATTGGAGATCTTGAAGG
rJMFF043G02+ ATTATGTGCAAGGACATCACCTGGCAAGGAGAAGTTTGTTGTGATTGGAGATCTTGAAGG
                      ____________________________________________________________
consensus ATTATGTGCAAGGACATCACCTGGCAAGGAGAAGTTTGTTGTGATTGGAGATCTTGAAGG
 
. : . : . : . : . : . :
JMFF015L13- TTTTGGGTATTCAAACAGTGATGTCAGGGGATATCTTGCATCTCTATCTATTCTACAGGA
rJMSF009L07+ TTTTGGGTATTCAAACAGTGATGTCAGGGGATATCTTGCATCTCTATCTATTCTACAGGA
rJMFF015L13+ TTTTGGGTATTCAAACAGTGATGTCAGGGGATATCTTGCATCTCTATCTATTCTACAGGA
rJMFF043G02+ TTTTGGGTATTCAAACAGTGATGTCAGGGGATATCTTGCATCTCTATCTATTCTACAGGA
                      ____________________________________________________________
consensus TTTTGGGTATTCAAACAGTGATGTCAGGGGATATCTTGCATCTCTATCTATTCTACAGGA
 
. : . : . : . : . : . :
JMFF015L13- TTTCTATCCA
rJMSF009L07+ TTTCTATCCAGAAAGATTAGGAAAATTGTTTGTTGTCCACGTGCCTTACCTGTTCTGGAC
rJMFF015L13+ TTTCTATCCAGAAAGATTAGGAAAATTGTTTGTTGTCCACGTGCCTTACCTGTTCTGGAC
rJMFF043G02+ TTTCTATCCAGAAAGATTAGGAAAATTGTTTGTTGTCCACGTGCCTTACCTGTTCTGGAC
                      ____________________________________________________________
consensus TTTCTATCCAGAAAGATTAGGAAAATTGTTTGTTGTCCACGTGCCTTACCTGTTCTGGAC
 
. : . : . : . : . : . :
rJMSF009L07+ ATTGTACAAAATTGTGTGCCCTTTCATTGATAACAATACCAAGAAAAAGATCATATTTGT
rJMFF015L13+ ATTGTACAAAATTGTGTGCCCTTTCATTGACAACAATACCAAGAAAAAGATCATATTTGT
rJMFF043G02+ ATTGTACAAAATTGTGTGCCCTTTCATTGACAACAATACCAAGAAAAAGATCATATTTGT
                      ____________________________________________________________
consensus ATTGTACAAAATTGTGTGCCCTTTCATTGACAACAATACCAAGAAAAAGATCATATTTGT
 
. : . : . : . : . : . :
rJMSF009L07+ AGAAAATAAACGGCTGACGTCAACTTTGTTGGAAGATATTGATGAGAGCCAGCTCCCAGA
rJMFF015L13+ AGAAAATAAACGGCTGACGTCAACTTTGTTGGAAGATATTGATGAGAGCCAGCTCCCAGA
rJMFF043G02+ AGAAAATAAACGGCTGACGTCAACTTTGTTGGAAGATATTGATGAGAGCCAGCTCCCAGA
                      ____________________________________________________________
consensus AGAAAATAAACGGCTGACGTCAACTTTGTTGGAAGATATTGATGAGAGCCAGCTCCCAGA
 
. : . : . : . : . : . :
rJMSF009L07+ GATCTATGGAGGCAAACAACCCTTAGTCCCTATCCACAATGCCTAATAATAAATCAGTAT
rJMFF015L13+ GATCTATGGAGGCAAACAACCCTTAGTCCCTATCCACAATGCCTAATAATAAATCAGTAT
rJMFF043G02+ GATCTATGGAGGCAAACAACCCTTAGTCCCTATCCACAATGCCTAATAATAAATCAGTAT
                      ____________________________________________________________
consensus GATCTATGGAGGCAAACAACCCTTAGTCCCTATCCACAATGCCTAATAATAAATCAGTAT
 
. : . : . : . : . : . :
rJMSF009L07+ TAATTGTACTC
rJMFF015L13+ TAATTGTACTCTTTTAACTATGGTTAAATTTGGAATTGGATCTACTTAAGAATACCGTAT
rJMFF043G02+ TAATTGTACTCTTTTAACTATGGTTAAATTTGGAATTGGATCTACTTAAGAATACCGTAT
                      ____________________________________________________________
consensus TAATTGTACTCTTTTAACTATGGTTAAATTTGGAATTGGATCTACTTAAGAATACCGTAT
 
. : . : . : . : . : . :
rJMFF015L13+ TCTTATTTCCAAGTATTACTCCATCTCCATCGGTGCCTATGTCATTTGACATGTATGTTT
rJMFF043G02+ TCTTATTTCCAAGTATTACTCCATCTCCATCGGTGCCTATGTCATTTGACATGTATGTTT
                      ____________________________________________________________
consensus TCTTATTTCCAAGTATTACTCCATCTCCATCGGTGCCTATGTCATTTGACATGTATGTTT
 
. : . : . : . : . : . :
rJMFF015L13+ ATTATTTATGAATCAAAT
rJMFF043G02+ ATTATTTATGAATCAAATTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus ATTATTTATGAATCAAATTAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG