Previous Contig 010302:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF013N07Sequence608003422 (17)636010302 (15)pir|B84659|B846594e-69probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>
JMFF024P07Sequence500010302 (15)gb:AP004991_18468525e-74Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN413010302 (15)gb:AY069973_15666644e-38Camelina sativa ER1-like receptor kinase (ERECTA1) gene, partial cds.
JMFF030I24Sequence539003422 (17)pir|B84659|B846598e-34probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>467010302 (15)pir|B84659|B846599e-53probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>
JMFF039J05Sequence247003422 (17)pir|B84659|B846591e-37probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>384010302 (15)pir|B84659|B846591e-26probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>
JMFF043B15Sequence343010302 (15)pir|B84659|B846593e-07probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>366010302 (15)pir|B84659|B846598e-09probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>
JMFF043F13Sequence742014954350010302 (15)
JMFF046J01Sequence175003422 (17)385010302 (15)pir|B84659|B846592e-24probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>
JMFN031C14Sequence636010302 (15)pir|B84659|B846591e-40probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>
JMFS014D08Sequence457010302 (15)pir|B84659|B846592e-29probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>
JMFS133G04Sequence621010302 (15)pir|B84659|B846593e-55probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>
JMFS163B09Sequence587010302 (15)gb:AP004991_18468526e-79Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJN
JMSF010C21Sequence333003422 (17)730010302 (15)pir|B84659|B846592e-85probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>
JMSF031J16Sequence647003422 (17)pir|B84659|B846598e-28probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>736010302 (15)pir|B84659|B846591e-92probable receptor-like protein kinase, ERECTA [imported] - Arabidopsis thaliana>

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS163B09- TGGGATTTGCTTACGGGGCGACTAAAAGGAAGAAACTTGATTGGGATAC
                      ____________________________________________________________
consensus TGGGATTTGCTTACGGGGCGACTAAAAGGAAGAAACTTGATTGGGATAC
 
. : . : . : . : . : . :
JMFS163B09- GCGTCTTCTGATTGCATTGGGTGCTGCTGAAGGGCTTGCATACCTTCACCATGATTGTAA
JMFF024P07- GCTTGCATACCTTCACCATGATTGTAA
rJMSF031J16+ CTGAAGGGCTTGCATACCTTCACCATGATTGTAA
rJMSF010C21+ GCTTGCATACCTTCACCATGATTGTAA
                      ____________________________________________________________
consensus GCGTCTTCTGATTGCATTGGGTGCTGCTGAAGGGCTTGCATACCTTCACCATGATTGTAA
 
. : . : . : . : . : . :
JMFS163B09- CCCGAGAATAA-TCCACCGGGACGTTAAGTCGTCAAACATTCTGTTAGATAAGGATTTCG
JMFF024P07- CCCGAGAATAA-TCCACCGGGACGTTAAGTCGTCAAACATTCTGTTAGATAAGGATTTCG
rJMSF031J16+ CCCGAGAATAA-TCCACCGGGACGTTAAGTCGTCAAACATTCTGTTAGATAAGGATTTCG
rJMSF010C21+ CCCGAGAATAATTCCACCGGGACGTTAAGTCGTCAAACATTCTGTTAGATAAGGATTTCG
                      ____________________________________________________________
consensus CCCGAGAATAA-TCCACCGGGACGTTAAGTCGTCAAACATTCTGTTAGATAAGGATTTCG
 
. : . : . : . : . : . :
JMFS163B09- AGGCTCATCTCACCGACTTTGGAATTGCAAAGAGCTTGTGCACATCCAAGTCCTATACTT
JMFF024P07- AGGCTCATCTCACCGACTTTGGAATTGCAAAGAGCTTGTGCACATCCAAGTCCTATACTT
rJMSF031J16+ AGGCTCATCTCACCGACTTTGGAATTGCAAAGAGCTTGTGCACATCCAAGTCCTATACTT
rJMSF010C21+ AGGCTCATCTCACCGACTTTGGAATTGCAAAGAGCTTGTGCACATCCAAGTCCTATACTT
rJMFF013N07+ GCAAAGAGCTTGTGCACATCCAAGTCCTATACTT
                      ____________________________________________________________
consensus AGGCTCATCTCACCGACTTTGGAATTGCAAAGAGCTTGTGCACATCCAAGTCCTATACTT
 
. : . : . : . : . : . :
JMFS163B09- CTACCTACATTATGGGAACCATTGGTTACATCGACCCTGAATATGCACGCACTTCCCGCC
JMFF024P07- CTACCTACATTATGGGAACCATTGGTTACATCGACCCTGAATATGCACGCACTTCCCGCC
rJMFF030I24+ TACATCGACCCTGAATATGCACGCACTTCCCGCC
rJMSF031J16+ CTACCTACATTATGGGAACCATTGGTTACATCGACCCTGAATATGCACGCACTTCCCGCC
rJMSF010C21+ CTACCTACATTATGGGAACCATTGGTTACATCGACCCTGAATATGCACGCACTTCCCGCC
rJMFF013N07+ CTACCTACATTATGGGAACCATTGGTTACATCGACCCTGAATATGCACGCACTTCCCGCC
JMFS133G04+ ATATGCACGCACTTCCCGCC
                      ____________________________________________________________
consensus CTACCTACATTATGGGAACCATTGGTTACATCGACCCTGAATATGCACGCACTTCCCGCC
 
. : . : . : . : . : . :
JMFS163B09- TTACTGAAAAGTCGGATGTATATAGCTATGGAATCGTCCTGCTGGAGTTGCTGACGGGAA
JMFF024P07- TTACTGAAAAGTCGGATGTATATAGCTATGGAATCGTCCTGCTGGAGTTGCTGACGGGAA
rJMFF030I24+ TTACTGAAAAGTCGGATGTATATAGCTATGGAATCGTCCTGCTGGAGTTGCTGACGGGAA
rJMSF031J16+ TTACTGAAAAGTCGGATGTATATAGCTATGGAATCGTCCTGCTGGAGTTGCTGACGGGAA
rJMSF010C21+ TTACTGAAAAGTCGGATGTATATAGCTATGGAATCGTCCTGCTGGAGTTGCTGACGGGAA
rJMFF013N07+ TNACTGAAAAGTCGGATGTATATAGCTATGGAATCGTCCTGCTGGAGTTGCTGACGGGAA
rJMFF024P07+ GTATATAGCTATGGNTTCGTCCTGCTGGAGTTGCTGACGGGAA
JMFS133G04+ TTACTGAAAAGTCGGATGTATATAGCTATGGAATCGTCCTGCTGGAGTTGCTGACGGGAA
JMFN031C14- CGGGAA
                      ____________________________________________________________
consensus TTACTGAAAAGTCGGATGTATATAGCTATGGAATCGTCCTGCTGGAGTTGCTGACGGGAA
 
. : . : . : . : . : . :
JMFS163B09- GGAAAGCTGTGGATAACGAGTCCAATCTCCATCATCTGATTCTAACAAAGGCGGCAAACA
JMFF024P07- GGAAAGCTGTGGATAACGAGTCCAATCTCCATCGTCTGATTCTAACAAAGGCGGCAAACA
rJMFF030I24+ GGAAAGCTGTGGATAACGAGTCCAATCTCCATCATCTGATTCTAACAAAGGCGGCAAACA
rJMSF031J16+ GGAAAGCTGTGGATAACGAGTCCAATCTCCATCATCTGATTCTAACAAAGGCGGCAAACA
rJMSF010C21+ GGAAAGCTGTGGATAACGAGTCCAATCTCCATCATCTGATTCTAACAAAGGCGGCAAACA
rJMFF013N07+ GGAAAGCTGTGGATAACGAGTCCAATCTCCATCATCTGATTCTAACAAAGGCGGCAAACA
rJMFF024P07+ GGAAAGCTGTGGATAACGAGTCCAATCTCCATCGTCTGATTTTANCAAAGGCGGCAAACA
JMFS133G04+ GGAAAGCTGTGGATAACGAGTCCAATCTCCATCATCTGATTCTAACAAAGGCGGCAAACA
JMFN031C14- GGAAAGCTGTGGATAACGAGTCCAATCTCCATCATCTGATTCTAACAAAGGCGGCAAACA
                      ____________________________________________________________
consensus GGAAAGCTGTGGATAACGAGTCCAATCTCCATCATCTGATTCTAACAAAGGCGGCAAACA
 
. : . : . : . : . : . :
JMFS163B09- ATGCAGTCATGGAAAGTGTCGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATG
JMFF024P07- ATGCAGTCATGGAAAGTGTCGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATT
rJMFF030I24+ ATGCAGTCATGGAAAGTGTCGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATG
rJMSF031J16+ ATGCAGTCATGGAAAGTGTCGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATG
rJMSF010C21+ ATGCAGTCATGGAAAGTGTCGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATG
rJMFF013N07+ ATGCAGTCATGGAAAGTGTCGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATG
rJMFF024P07+ ATGCAGTCATGGAAAGTGTNGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATT
rJMFF039J05+ TACATGTCAGGACCTTGGAGATG
JMFS133G04+ ATGCAGTCATGGAAAGTGTCGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATG
JMFS014D08+ TGAGATCTCGGCTACATGTCAGGACCTTGGAGATG
JMFN031C14- ATGCAGTCATGGAAAGTGTCGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATG
                      ____________________________________________________________
consensus ATGCAGTCATGGAAAGTGTCGATGCTGAGATCTCGGCTACATGTCAGGACCTTGGAGATG
 
. : . : . : . : . : . :
JMFS163B09- TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
JMFF024P07- TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
rJMFF030I24+ TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
rJMSF031J16+ TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
rJMSF010C21+ TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGGGAGGCCGT
rJMFF013N07+ TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
rJMFF046J01+ GAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
rJMFF024P07+ TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCNCCAAGAGGCAGCCATNTGAGAGGCCGT
rJMFF039J05+ TGAAGAAGGTTTTCCAGCGTGCTNTTNTNTGCACCAAGAGGCAGCCATNTGAGAGGCCGT
JMFS133G04+ TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
JMFS014D08+ TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
JMFN031C14- TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
                      ____________________________________________________________
consensus TGAAGAAGGTTTTCCAGCTTGCTCTTCTTTGCACCAAGAGGCAGCCATCTGAGAGGCCGT
 
. : . : . : . : . : . :
JMFS163B09- CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAG
JMFF024P07- CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAA
rJMFF030I24+ CCATGCACGAAGTTGCTNGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAGG
rJMSF031J16+ CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAGG
rJMSF010C21+ CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAGG
rJMFF013N07+ CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAGG
rJMFF046J01+ CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAGG
rJMFF024P07+ CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAGG
rJMFF039J05+ CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCNTCATCCCATCCAAAACAGG
JMFS133G04+ CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAGG
JMFS014D08+ CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAGG
JMFN031C14- CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTTATCCCATCCAAAACAGG
                      ____________________________________________________________
consensus CCATGCACGAAGTTGCTCGAGTTCTCGGGAGCCTAATGCCCTCATCCCATCCAAAACAGG
 
. : . : . : . : . : . :
rJMFF030I24+ TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGCTAAAGTGCCTTGTTACATGGATG
rJMSF031J16+ TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGCTAAAGTGCCTTGTTACATGGATG
rJMSF010C21+ TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGCTAAAGTGCCTTGTTACATGGATG
rJMFF013N07+ TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGCTAAAGTGCCTTGTTACATGGATG
rJMFF046J01+ TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGCTAAAGTGCCTTGTTACATGGATG
rJMFF024P07+ TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGATAAAGTGCCTTGTTACATGGATG
rJMFF039J05+ TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGCTAAAGTGCCTTGTTACATGGATG
JMFS133G04+ TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGCTAAAGTGCCTTGTTACATGGATG
JMFS014D08+ TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGGTAAAGTGCCTTGTTACATGGATG
JMFN031C14- TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGCTAAAGTGCCTTGTTACATGGATG
JMFF043B15- ATG
rJMFF043B15+ TTACATGGATG
                      ____________________________________________________________
consensus TGAACCAAACCCCCTCACTTGCACCCTTACCATCTGCTAAAGTGCCTTGTTACATGGATG
 
. : . : . : . : . : . :
rJMFF030I24+ AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
rJMSF031J16+ AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
rJMSF010C21+ AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
rJMFF013N07+ AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
rJMFF046J01+ AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
rJMFF024P07+ AATACACAAATCTCAGAACCCCCCAGTTATTAACNTGCCCATCCATGAGCACCTCA
rJMFF039J05+ AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
JMFS133G04+ AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
JMFS014D08+ AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
JMFN031C14- AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
JMFF043B15- AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
rJMFF043B15+ AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
                      ____________________________________________________________
consensus AATACACAAATCTCAGAACCCCCCAGTTATTAACCTGCCCATCCATGAGCACCTCAGATG
 
. : . : . : . : . : . :
rJMFF030I24+ CCCAACTCTTTCT
rJMSF031J16+ CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CCTGAAGATTCTTG
rJMSF010C21+ CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CCTGAAGATTCTTG
rJMFF013N07+ CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTACCCTGAAGATTCTTG
rJMFF046J01+ CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CCTGAAGATTCTTG
rJMFF039J05+ CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CNTGAAGATTCTNG
JMFS133G04+ CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CCTGAAGATTCTTG
JMFS014D08+ CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CCTGAAGATTCTTG
JMFN031C14- CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CCTGAAGATTCTTG
JMFF043B15- CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CCTGAAGATTCTTG
rJMFF043B15+ CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CCTGAAGATTCTTG
                      ____________________________________________________________
consensus CCCAACTCTTTCTCAAATTTGGAGAAGTCATTTCCCAGAACAGTA-CCTGAAGATTCTTG
 
. : . : . : . : . : . :
rJMSF031J16+ GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCAT
rJMSF010C21+ GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCAT
rJMFF013N07+ GATTTTCNCCTTCCAAAAAAGGAACAAAGAAAACCATTATCCCACAGCAAAGTATGAAGG
rJMFF046J01+ GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCATTATCCCACAGCAAAGTATGAAGG
rJMFF039J05+ GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCATTATCCCACAGCAAAGTATGAAGG
JMFS133G04+ GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCATTATCCCACAGCAAAGTATGAAGG
JMFS014D08+ GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCATTATCCCACAGCAAAGTATGAAGG
JMFN031C14- GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCATTATCACACAGCAAAGTATGAAGG
JMFF043B15- GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCATTATCCCACAGCAAAGTATGAAGA
rJMFF043B15+ GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCATTATCCCACAGCAAAGTATGAAGA
rJMFF043F13+ AAAGTATGAAGA
                      ____________________________________________________________
consensus GATTTTCACCTTCCAAAAAAGGAACAAAGAAAACCATTATCCCACAGCAAAGTATGAAGG
 
. : . : . : . : . : . :
rJMFF013N07+ AC
rJMFF046J01+ ACTCTGATGGCTAAATATTGCAGTTAGTAG
rJMFF039J05+ AC
JMFS133G04+ ACTCTGATGGCTAAATATTGCAGTTAGTAGAAAAAAAAAAAAAAAA
JMFS014D08+ ACTCTGATGGCTAAATATTGCAGTTAGTAGAAAAAAAAAAAAAAAA
JMFN031C14- ACTCTGATGGCTAAATATTGCAGTTAGTAGAAAAAAAAAAAAAAAAATATGGACAAGACC
JMFF043B15- ACTCTGATGGCTAAATATTGCAGTTAGTAG-AAAAAAAAAAAAAAAATATGGACAAGACC
rJMFF043B15+ ACTCTGATGGCTAAATATTGCAGTTAGTAG-AAAAAAAAAAAAAAAATATGGACAAGACC
rJMFF043F13+ ACTTTGAGGGTTAAATATTGCAGTTAGTTG-AAAAAAGGAGGAAAAATATGGTCAAGGCC
                      ____________________________________________________________
consensus ACTCTGATGGCTAAATATTGCAGTTAGTAGAAAAAAAAAAAAAAAAATATGGACAAGACC
 
. : . : . : . : . : . :
JMFN031C14- ATTAAGCTAACATCTTTAGAGTGTAGCACCAAATTGATGTATATTAATTTAACTTGTACT
JMFF043B15- ATTAAGCTAACATCTTTAGAGTGTAGCACCAAATTGATGTATATTAATTTAACTTGTACT
rJMFF043B15+ ATTAAGCTAACATCTTTAGAGTGTAGCACCAAATTGATGTATATTAATTTAACTTGTACT
rJMFF043F13+ ATTAAGTTAGCATTTTTAGAGTGTAGCACCAAATTGATGTATATTAATTTAAATAGTAAT
                      ____________________________________________________________
consensus ATTAAGCTAACATCTTTAGAGTGTAGCACCAAATTGATGTATATTAATTTAACTTGTACT
 
. : . : . : . : . : . :
JMFN031C14- CCACCCAAA
JMFF043B15- CCACCCAAA
rJMFF043B15+ CCACCCAAA
rJMFF043F13+ CCACCCAAAAATACAAGTATAAGGGTAATAGGTAATAGGGATCAAAAAAAAAAAAAAACT
                      ____________________________________________________________
consensus CCACCCAAAAATACAAGTATAAGGGTAATAGGTAATAGGGATCAAAAAAAAAAAAAAACT