Previous Contig 010300:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043F09Sequence647010300 (9)gb:AC149302_17450133e-79Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.617010300 (9)gb:AC149302_17450132e-34Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.
JMFF051E09Sequence594010300 (9)gb:AC149302_17450137e-75Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.498010300 (9)gb:AJ583017_18113376e-24Beta vulgaris mRNA for 4,5-DOPA dioxygenase extradiol (doda gene).
JMSF032K08Sequence703019719gb:BT002983_16365666e-46Arabidopsis thaliana clone RAFL15-19-L01 (R20455) putative cytochrome c oxidored741010300 (9)sp|Q949R4|DIOL_ARATH9e-624,5-DOPA dioxygenase extradiol-like protein.>gb:AY050948_1562433 Arabidopsis tha
JMSF037M19Sequence638010300 (9)gb:AC149302_17450133e-80Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.652010300 (9)gb:AC149302_17450131e-49Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.
JMSF046D07Sequence761010300 (9)gb:AC149302_1745013e-101Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.668010300 (9)gb:AC149302_17450131e-51Solanum demissum chromosome 11 clone PGEC400L14 map MAP_LOC, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF043F09- CCTTGGCGATAGAAAAAACAAAAAAGTGAAT
JMSF037M19- AGAAAAAACAAAAAAGTGAAT
JMSF046D07- AGAAAAAACAAAAAAGTGAAT
                      ____________________________________________________________
consensus CCTTGGCGATAGAAAAAACAAAAAAGTGAAT
 
. : . : . : . : . : . :
JMFF043F09- CGAATTGCAGAATGGCTGGTGTTTTGGCTTTGAACGAGACGTTCTTCATATCTCATGGCT
JMSF037M19- CGAATTGCAGAATGGCTGGTGTTTTGGTTTTGAACGAGACGTTCTTCATATCTCATGGCT
JMFF051E09- ATGGCT
JMSF046D07- CGAATTGCAGAATGGCTGGTGTTTTGGCTTTGAACGAGACGTTCTTCATATCTCATGGCT
                      ____________________________________________________________
consensus CGAATTGCAGAATGGCTGGTGTTTTGGCTTTGAACGAGACGTTCTTCATATCTCATGGCT
 
. : . : . : . : . : . :
JMFF043F09- CGCCGACTCTCTCCATCGATGATTCGTTGCCAGCCCGCCATTTC-CTCAAAGCCTTCCGA
JMSF037M19- CGCCGACTCTCTCCATCGATGATTCGTTGCCAGCCCGCCATTTC-CTCAAAGCCTTCCGA
JMFF051E09- CGCCGACTCTCTCCATCGATGATTCGTTGCCAGCCCGCCATTTCACTCAAAGCCTTCCGA
JMSF046D07- CGCCGACTCTCTCCATCGATGATTCGTTGCCAGCCCGCCATTTC-CTCAAAGCCTTCCGA
                      ____________________________________________________________
consensus CGCCGACTCTCTCCATCGATGATTCGTTGCCAGCCCGCCATTTC-CTCAAAGCCTTCCGA
 
. : . : . : . : . : . :
JMFF043F09- GAGAAAGTCTTCCCGCAGAAGCCCACCTCCATTCTCGTCATCTCCGCCCACTGGGAGACC
JMSF037M19- GAGAAAGTCTTCCCGCAGAAGCCCACCTCCATTCTCGTCATCTCCGCCCACTGGGAGACC
JMFF051E09- GAGAAAGTCTTCCCGCAGAAGCCCACCTCCATTCTCGTCATCTCCGCCCACTGGGAGACC
JMSF046D07- GAGAAAGTCTTCCCGCAGAAGCCCACCTCCATTCTCGTCATCTCCGCCCACTGGGAGACC
                      ____________________________________________________________
consensus GAGAAAGTCTTCCCGCAGAAGCCCACCTCCATTCTCGTCATCTCCGCCCACTGGGAGACC
 
. : . : . : . : . : . :
JMFF043F09- TCCGTCCCCACCATCAACGTCATCCGTGGCCGCAACGACACCATCCATGACTTCTACGGT
JMSF037M19- TCCGTCCCCACCATCAACGTCATCCGTGGCCGCAACGACACCATCCATGACTTCTACGGT
JMFF051E09- TCCGTCCCCACCATCAACGTCATCCGTGGCCGCAACGACACCATCCATGACTTCTACGGT
JMSF046D07- TCCGTCCCCACCATCAACGTCATCCGTGGCCGCAACGACACCATCCATGACTTCTACGGT
                      ____________________________________________________________
consensus TCCGTCCCCACCATCAACGTCATCCGTGGCCGCAACGACACCATCCATGACTTCTACGGT
 
. : . : . : . : . : . :
JMFF043F09- TTCCCCAAGCAAATGTATCAGCTCAAGTACCCCGCACCTGGAGCTCCAGAGTTGGCAAAA
JMSF037M19- TTCCCCAAGCAAATGTATCAGCTCAAGTACCCCGCACCTGGAGCTCCAGAGTTGGCAAAA
JMFF051E09- TTCCCCAAGCAAATGTATCAGCTCAAGTACCCCGCACCTGGAGCTCCAGAGTTGGCAAAA
JMSF046D07- TTCCCCAAGCAAATGTATCAGCTCAAGTACCCCGCACCTGGAGCTCCAGAGTTGGCAAAA
                      ____________________________________________________________
consensus TTCCCCAAGCAAATGTATCAGCTCAAGTACCCCGCACCTGGAGCTCCAGAGTTGGCAAAA
 
. : . : . : . : . : . :
JMFF043F09- AGGGCAATTGAATTGCTCGAGTCCTCCGGGGTCAAGAAAGTTGATGTAGACACTAAACGT
JMSF037M19- AGGGCAATTGAATTGCTCGAGTCCTCCGGGGTCAAGAAAGTTGATGTAGACACTAAACGT
JMFF051E09- AGGGCAATTGAATTGCTCGAGTCCTCCGGGGTCAAGAAAGTTGATGTAGACACTAAACGT
JMSF046D07- AGGGCAATTGAATTGCTCGAGTCCTCCGGGGTCAAGAAAGTTGATGTAGACACTAAACGT
rJMSF032K08+ TGCTCGAGTCCTCCGGGGTCAAGAAAGTTGATGTAGACACTAAACGT
                      ____________________________________________________________
consensus AGGGCAATTGAATTGCTCGAGTCCTCCGGGGTCAAGAAAGTTGATGTAGACACTAAACGT
 
. : . : . : . : . : . :
JMFF043F09- GGTTTGGACCATGGTGCATGGGTTCCTCTTATGCTCATGTATCCAGAGGCTGACATCCCG
JMSF037M19- GGTTTGGACCATGGTGCATGGGTTCCTCTTATGCTCATGTATCCAGAGGCTGACATCCCG
JMFF051E09- GGTTTGGACCATGGTGCATGGGTTCCTCTTATGCTCATGTATCCAGAGGCTGACATCCCG
JMSF046D07- GGTTTGGACCATGGTGCATGGGTTCCTCTTATGCTCATGTATCCAGAGGCTGACATCCCG
rJMSF046D07+ TGCTCATGTATCCAGAGGCTGACATCCCG
rJMSF037M19+ ATCCAGAGGCTGACATCCCG
rJMSF032K08+ GGTTTGGACCATGGTGCATGGGTTCCTCTTATGCTCATGTATCCAGAGGCTGACATCCCG
                      ____________________________________________________________
consensus GGTTTGGACCATGGTGCATGGGTTCCTCTTATGCTCATGTATCCAGAGGCTGACATCCCG
 
. : . : . : . : . : . :
JMFF043F09- GTTTGCCAGCTTTCTGTCCAGACACAAATGGACGGAACCTATCATTACAATTTGGGTAAA
JMSF037M19- GTTTGCCAGCTTTCTGTCCAGACACAAATGGACGGAACCTATCATTACAATTTGGGTAAA
JMFF051E09- GTTTGCCAGCTTTCTGTCCAGACACAAATGGACGGAACCTATCATTACAATTTGGGTAAA
JMSF046D07- GTTTGCCAGCTTTCTGTCCAGACACAAATGGACGGAACCTATCATTACAATTTGGGTAAA
rJMSF046D07+ GTTTGCCAGCTTTCTGTCCAGACACAAATGGACGGAACCTATCATTACAATTTGGGTAAA
rJMSF037M19+ GTTTGCCAGCTTTCTGTCCAGACACAAATGGACGGAACCTATCATTACAATTTGGGTAAA
rJMSF032K08+ GTTTGCCAGCTTTCTGTCCAGACACAAATGGACGGAACCTATCATTACAATTTGGGTAAA
rJMFF043F09+ TCATTACAA-TTGGGTAAA
                      ____________________________________________________________
consensus GTTTGCCAGCTTTCTGTCCAGACACAAATGGACGGAACCTATCATTACAATTTGGGTAAA
 
. : . : . : . : . : . :
JMFF043F09- GCCTTGGCTACTCTTAAGAAAGAAGGTGTTCTCATATTTGGTTCTGGATCTGCCACTCAT
JMSF037M19- GCCTTGGCTACTCTTAAGAAAGAAGGTGTTCTCATATTTGGTTCTGGATCTGCCACTCAT
JMFF051E09- GCCTTGGCTACTCTTAAGAAAGAAGGTGTTCTCATATTTGGTTCTGGATCTGCCACTCAT
JMSF046D07- GCCTTGGCTACTCTTAAGAAAGAAGGTGTTCTCATATTTGGTTCTGGATCTGCCACTCAT
rJMSF046D07+ GCCTTGGCTACTCTTAAGAAAGAAGGTGTTCTCATATTTGGTTCTGGATCTGCCACTCAT
rJMSF037M19+ GCCTTGGCTACTCTTAAGAAAGAAGGTGTTCTCATATTTGGTTCTGGATCTGCCACTCAT
rJMSF032K08+ GCCTTGGCTACTCTTAAGAAAGAAGGTGTTCTCATATTTGGTTCTGGATCTGCCACTCAT
rJMFF043F09+ GCCTTGGCTA-TCTTAAGAAAGAAGGTGTTCTCATATNTGGTTCTGGATCTGCCACTCAT
                      ____________________________________________________________
consensus GCCTTGGCTACTCTTAAGAAAGAAGGTGTTCTCATATTTGGTTCTGGATCTGCCACTCAT
 
. : . : . : . : . : . :
JMFF043F09- AACTTAAGGGCTCCCCGTGATGGCCCTCCTGCTTCTTGGGCTAAAGAGTTTGATGATTGG
JMSF037M19- AACTTAAGGGCTCCCCGTGATGGCCCTCCTGCTTCTTGGGCTAAAGAGTTTGATGATTGG
JMFF051E09- AACTTAAGGGCTCCCCGTGATGGCCCTCCTGCTTCTTGGGCTANAGAGTTTGATGATTGG
JMSF046D07- AACTTAAGGGCTCCCCGTGATGGCCCTCCTGCTTCTTGGGCTAAAGAGTTTGATGATTGG
rJMSF046D07+ AACTTAAGGGCTCCCCGTGATGGCCCTCCTGCTTCTTGGGCTAAAGAGTTTGATGATTGG
rJMSF037M19+ AACTTAAGGGCTCCCCGTGATGGCCCTCCTGCTTCTTGGGCTAAAGAGTTTGATGATTGG
rJMSF032K08+ AACTTAAGGGCTCCCCGTGATGGCCCTCCTGCTTCTTGGGCTAAAGAGTTTGATGATTGG
rJMFF051E09+ AAAGAGTTTGATGATTGG
rJMFF043F09+ AACTTAAGGGCTCCCCGTGATGGCCCTCCTGCTTCTTGGGCTAAAGAGTTTGATGATTGG
                      ____________________________________________________________
consensus AACTTAAGGGCTCCCCGTGATGGCCCTCCTGCTTCTTGGGCTAAAGAGTTTGATGATTGG
 
. : . : . : . : . : . :
JMSF037M19- CTCAAGGATACTACTCT
JMFF051E09- CTNCAGGATACTACTCTNCATGGAAGGTATGAAGACATTAACCAGTAT
JMSF046D07- CTCAAGGATACTACTCTCAATGGAAGGTATGAAGACATTAACCAGTATGAAGTAAAGGCA
rJMSF046D07+ CTCAAGGATACTACTCTCAATGGAAGGTATGAAGACATTAACCAGTATGAAGTAAAGGCA
rJMSF037M19+ CTCAAGGATACTACTCTCAATGGAAGGTATGAAGACATTAACCAGTATGAAGTAAAGGCA
rJMSF032K08+ CTCAAGGATACTACTCTCAATGGAAGGTATGAAGACATTAACCAGTATGAAGTAAAGGCA
rJMFF051E09+ CTCAAGGATACTACTCTCAATGGAAGGTATGAAGACATTAACCAGTATGAAGTAAAGGCA
rJMFF043F09+ CTCAAGGATACTACTCTCAATGGAAGGTATGAAGACATTAACCAGTATGAAGTAAAGGCA
                      ____________________________________________________________
consensus CTCAAGGATACTACTCTCAATGGAAGGTATGAAGACATTAACCAGTATGAAGTAAAGGCA
 
. : . : . : . : . : . :
JMSF046D07- CCACATGCAAAAGTTAATCACCCATGGCCAGAACACTTCTATCCATTACATGTTGCAATT
rJMSF046D07+ CCACATGCAAAAGTTAATCACCCATGGCCAGAACACTTCTATCCATTACATGTTGCAATT
rJMSF037M19+ CCACATGCAAAAGTTAATCACCCATGGCCAGAACACTTCTATCCATTACATGTTGCAATT
rJMSF032K08+ CCACATGCAAAAGTTAATCACCCATGGCCAGAACACTTCTATCCATTACATGTTGCAATT
rJMFF051E09+ CCACATGCAAAAGTTAATCACCCATGGCCAGAACACTTCTATCCATTACATGTTGCAATT
rJMFF043F09+ CCACATGCAAAAGTTAATCACCCATGGCCAGAACACTTCTATCCATTACATGTTGCAATT
                      ____________________________________________________________
consensus CCACATGCAAAAGTTAATCACCCATGGCCAGAACACTTCTATCCATTACATGTTGCAATT
 
. : . : . : . : . : . :
JMSF046D07- GGTGCTGCTGGTGGAAACCC
rJMSF046D07+ GGTGCTGCTGGTGGAAACCCCAGAGCGGAACTTATTCACAATAGCTGGGGCAATGGTGGC
rJMSF037M19+ GGTGCTGCTGGTGGAAACCCCAGAGCGGAACTTATTCACAATAGCTGGGGCAATGGTGGC
rJMSF032K08+ GTTGCTGCTGGTGGAAACCCCAGAGCGGAACTTATTCACAATAGCTGGGGCAATGGTGGC
rJMFF051E09+ GGTGCTGCTGGTGGAAACCCCAGAGCGGAACTTATTCACAATAGCTGGGGCAATGGTGGC
rJMFF043F09+ GGTGCTGCTGGTGGAAACCCCAGAGCGGAACTTATTCACAATAGCTGGGGCAATGGTGGC
                      ____________________________________________________________
consensus GGTGCTGCTGGTGGAAACCCCAGAGCGGAACTTATTCACAATAGCTGGGGCAATGGTGGC
 
. : . : . : . : . : . :
rJMSF046D07+ TCGCTCTCCTATACTTCCTTGAAGTTCACAGAATAGCGCTTCAGAGATCAATGCTTGTGC
rJMSF037M19+ TCGCTCTCCTATACTTCCTTGAAGTTCACAGAATAGCGCTTCAGAGATCAATGCTTGTGC
rJMSF032K08+ TCGCTCTCCTATACTTCCTTGAAGTTCACAGAATAGCGCTTCAGAGATCAATGCTTGTGC
rJMFF051E09+ TCGCTCTCCTATACTTCCTTGAAGTTCACAGAATAGCGCTTCAGAGATCAATGCTTGTGC
rJMFF043F09+ TCGCTCTCCTATACTTCCTTGAAGTTCACAGAATAGCGCTTCAGAGATCAATGCTTGTGC
                      ____________________________________________________________
consensus TCGCTCTCCTATACTTCCTTGAAGTTCACAGAATAGCGCTTCAGAGATCAATGCTTGTGC
 
. : . : . : . : . : . :
rJMSF046D07+ ATAATAACCATTGTTTAATGTATTGTTATGAATATTGTATCAGCTTATTTACCCAATAGG
rJMSF037M19+ ATAATAACCATTGTTTAATGTATTGTTATGAATATTGTATCAGCTTATTTACCCAATAGG
rJMSF032K08+ ATAATAACCATTGTTTAATGTATTGTTATGAATATTGTATCAGCTTATTTACCCAATAGG
rJMFF051E09+ ATAATAACCATTGTTTAATGTATTGTTATGAATATTGTATCAGCTTATTTACCCAATAGG
rJMFF043F09+ ATAATAACCATTGTTTAATGTATTGTTATGAATATTGTATCAGCTTATTTACCCAATAGG
                      ____________________________________________________________
consensus ATAATAACCATTGTTTAATGTATTGTTATGAATATTGTATCAGCTTATTTACCCAATAGG
 
. : . : . : . : . : . :
rJMSF046D07+ ATAAGAGTGGATGATGAATTTAAATATTGTACTAGTTTATTTACTCAACAGGATAGGAGT
rJMSF037M19+ ATAAGAGTGGATGATGAATTTAAATATTGTACTAGTTTATTTACTCAACAGGATAGGAGT
rJMSF032K08+ ATAAGAGTGGATGATGAATTTAAATATTGTACTAGTTTATTTACTCAACAGGATAGGAGT
rJMFF051E09+ ATAAGAGTGGATGATGAATTTAAATATTGTACTAGTTTATTTACTCAACAGGATAGGAGT
rJMFF043F09+ ATAAGAGTGGATGATGAATTTAAATATTGTACTAGTTTATTTACTCAACAGGATAGGAGT
                      ____________________________________________________________
consensus ATAAGAGTGGATGATGAATTTAAATATTGTACTAGTTTATTTACTCAACAGGATAGGAGT
 
. : . : . : . : . : . :
rJMSF046D07+ TGGTGATGAGTTTAAATAAACCATGTGACAGTGATGACTAGAATATCCTGTCTTTGGTTG
rJMSF037M19+ TGGTGATGAGTTTAAATAAACCATGTGACAGTGATGACTAGAATATCCTGTCTTTGGTTG
rJMSF032K08+ TGGTGATGAGTTTAAATAAACCATGTGACAGTGATGACTAGAATATCCTGTCTTTGGTTG
rJMFF051E09+ TGGTGATGAGTTTAAATAAACCATGTGACAGTGATGACTAGAATGTCCTGTCTTTGGTTG
rJMFF043F09+ TGGTGATGAGTTTAAATAAACCATGTGACAGTGATGACTAGAATATCCTGTCTTTGGTTG
                      ____________________________________________________________
consensus TGGTGATGAGTTTAAATAAACCATGTGACAGTGATGACTAGAATATCCTGTCTTTGGTTG
 
. : . : . : . : . : . :
rJMSF046D07+ AAGATAATGTAAATCGAATATTCTCAGTGC
rJMSF037M19+ AAGATAATGTAAATCGAATATTCTCAGTGCAT
rJMSF032K08+ AAGATAATGTAAATCGAATATTCTCAGTGCAT
rJMFF051E09+ AAGATAATGTAAATCGAATATTCTCAGTGCATTGTTATTGTTATATAATTCTTTATGTAT
rJMFF043F09+ AAGATAATGTAAATCGAATATTCTCAGTGCATTGTTATTGTTATATAATTCTTTATGTAT
                      ____________________________________________________________
consensus AAGATAATGTAAATCGAATATTCTCAGTGCATTGTTATTGTTATATAATTCTTTATGTAT