Previous Contig 010293:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF043E03Sequence627005700 (8)gb:AF302661_17843123e-74Arabidopsis thaliana ubiquitin-specific protease 7 (UBP7) gene, complete cds.626010293 (10)gb:AF302660_17843119e-42Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene, complete cds.
JMFF047L14Sequence638005700 (8)gb:AF302661_17843121e-71Arabidopsis thaliana ubiquitin-specific protease 7 (UBP7) gene, complete cds.521010293 (10)gb:AF302660_17843113e-37Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene, complete cds.
JMFS157A07Sequence604010293 (10)gb:AF302660_17843113e-80Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene, complete cds.
JMSF009G06Sequence396005700 (8)gb:AP004225_18389502e-45Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B115745010293 (10)gb:AF302660_17843119e-83Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene, complete cds.
JMSF010M13Sequence340005700 (8)gb:AF302661_17843127e-34Arabidopsis thaliana ubiquitin-specific protease 7 (UBP7) gene, complete cds.731010293 (10)gb:AF302660_17843114e-78Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene, complete cds.
JMSF013C24Sequence200005700 (8)gb:AB023045_15155203e-10Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8.728010293 (10)gb:AF302660_17843115e-88Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene, complete cds.
JMSF017K04Sequence563005700 (8)gb:AP004225_18389501e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B115755010293 (10)pir|A96556|A965563e-77probable tRNA-guaninine transglycosylase [imported] - Arabidopsis thaliana>gb:AE
JMSF032J02Sequence597010293 (10)gb:AF302660_17843112e-60Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene, complete cds.
JMSF032K03Sequence701005700 (8)gb:AF302661_17843121e-81Arabidopsis thaliana ubiquitin-specific protease 7 (UBP7) gene, complete cds.680010293 (10)gb:AF302660_17843113e-82Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene, complete cds.
JMSF034F11Sequence683005700 (8)gb:AF302661_17843124e-82Arabidopsis thaliana ubiquitin-specific protease 7 (UBP7) gene, complete cds.718010293 (10)gb:AF302660_17843111e-63Arabidopsis thaliana ubiquitin-specific protease 6 (UBP6) gene, complete cds.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFS157A07- AAGCTTCTCCTTCTTTAGGTCGCAGTGCATTCCCTTAAATGCCACATTTCAC
                      ____________________________________________________________
consensus AAGCTTCTCCTTCTTTAGGTCGCAGTGCATTCCCTTAAATGCCACATTTCAC
 
. : . : . : . : . : . :
JMFS157A07- AGGAGGTGAACCATTTGCACGAGGGTTTAAAACGT-GGCTTGAAATCAGAACTGGAGAAA
rJMSF013C24+ TTTAAAACGTGGGCTTGAAATCAGAACTGGAGAAA
                      ____________________________________________________________
consensus AGGAGGTGAACCATTTGCACGAGGGTTTAAAACGTGGGCTTGAAATCAGAACTGGAGAAA
 
. : . : . : . : . : . :
JMFS157A07- GCTTCTCCTTCTTTAGGTCGCAGTGCAATTTACCTAAAAGATTCTCGAATTAATGGTTTG
rJMSF013C24+ GCTTCTCCTTCTTTAGGTCGCAGTGCAATTTACCTAAAAGATTCTCGAATTAATGGTTTG
rJMSF032K03+ AGGTCGCAGTGCAATTTACCTAAAAGATTCTCGAATTAATGGTTTG
rJMSF009G06+ TCTTTAGGTCGCAGTGCAATTTACCTAAAAGATTCTCGAATTAATGGTTTG
rJMSF017K04+ TCTTTAGGTCGCAGTGCAATTTACCTAAAAGATTCTCGAATTAATGGTTTG
rJMSF034F11+ GAATTAATGGTTTG
rJMSF010M13+ ATTAATGGTTTG
                      ____________________________________________________________
consensus GCTTCTCCTTCTTTAGGTCGCAGTGCAATTTACCTAAAAGATTCTCGAATTAATGGTTTG
 
. : . : . : . : . : . :
JMFS157A07- CCAAGATACTTGACCATTCAGTTTGTTCGATTTTTCTGGAAAAGGGAATCAAATCAAAAG
rJMSF013C24+ CCAAGATACTTGACCATTCAGTTTGTTCGATTTTTCTGGAAAAGGGAATCAAATCAAAAG
rJMSF032K03+ CCAAGATACTTGACCATTCAGTTTGTTCGATTTTTCTGGAAAAGGGAATCAAATCAAAAG
rJMSF032J02+ TCAAAAG
rJMSF009G06+ CCAAGATACTTGACCATTCAGTTTGTTCGATTTTTCTGGAAAAGGGAATCAAATCAAAAG
rJMSF017K04+ CCAAGATACTTGACCATTCAGTTTGTTCGATTTTTCTGGAAAAGGGAATCAAATCAAAAG
rJMSF034F11+ CCAAGATACTTGACCATTCAGTTTGTTCGATTTTTCTGGAAAAGGGAATCAAATCAAAAG
rJMSF010M13+ CCAAGATACTTGACCATTCAGTTTGTTCGATTTTTCTGGAAAAGGGAATCAAATCAAAAG
                      ____________________________________________________________
consensus CCAAGATACTTGACCATTCAGTTTGTTCGATTTTTCTGGAAAAGGGAATCAAATCAAAAG
 
. : . : . : . : . : . :
JMFS157A07- GCAAAGATTTTGCGGAAAGTAGATTATCCATTGGAATTGGATGTCTTTGACTTGTGTTCA
rJMSF013C24+ GCAAAGATTTTGCGGAAAGTAGATTATCCATTGGAATTGGATGTCTTTGACTTGTGTTCA
rJMSF032K03+ GCAAAGATTTTGCGGAAAGTAGATTATCCATTGGAATTGGATGTCTTTGACTTGTGTTCA
rJMSF032J02+ GCAAAGATTTTGNGGAAAGTAGATTATCCATTGGAATTGGATGTCTTTGANTTGTGNTCA
rJMSF009G06+ GCAAAGATTTTGCGGAAAGTAGATTATCCATTGGAATTGGATGTCTTTGACTTGTGTTCA
rJMSF017K04+ GCAAAGATTTTGCGGAAAGTAGATTATCCATTGGAATTGGATGTCTTTGACTTGTGTTCA
rJMSF034F11+ GCAAAGA--TTGCGGAAAGTAGATTATCCATTGGAATTGGATGTCTTTGACTTGTGTTCA
rJMSF010M13+ GCAAAGATTTTGCGGAAAGTAGATTATCCATTGGAATTGGATGTCTTTGACTTGTGTTCA
                      ____________________________________________________________
consensus GCAAAGATTTTGCGGAAAGTAGATTATCCATTGGAATTGGATGTCTTTGACTTGTGTTCA
 
. : . : . : . : . : . :
JMFS157A07- GATGATCTGCGCAAGAGATTGGAAGGTCCTCGCAAGGCTTTAAGAGATGAGGAGGGTAAG
rJMSF013C24+ GATGATCTGCGCAAGAGATTGGAAGGTCCTCGCAAGGCTTTAAGAGATGAGGAGGGTAAG
rJMSF032K03+ GATGATCTGCGCAAGAGATTGGAAGGTCCTCGCAAGGCTTTAAGAGATGAGGAGGGTAAG
rJMSF032J02+ GATGATCTGCNCAAGAGATTGGAAGGTCCTCNCAAGGCTNTAAGAGATGAGGAGGGTAAG
rJMSF009G06+ GATGATCTGCGCAAGAGATTGGAAGGTCCTCGCAAGGCTTTAAGAGATGAGGAGGGTAAG
rJMSF017K04+ GATGATCTGCGCAAGAGATTGGAAGGTCCTCGCAAGGCTTTAAGAGATGAGGAGGGTAAG
rJMSF034F11+ GATGATCTGCGCAAGAGATTGGAAGGTCCTCGCAAGGCTTTAAGAGATGAGGAGGGTAAG
rJMSF010M13+ GATGATCTGCGCAAGAGATTGGAAGGTCCTCGCAAGGCTTTAAGAGATGAGGAGGGTAAG
                      ____________________________________________________________
consensus GATGATCTGCGCAAGAGATTGGAAGGTCCTCGCAAGGCTTTAAGAGATGAGGAGGGTAAG
 
. : . : . : . : . : . :
JMFS157A07- AAACTTGGTTTACAAGCTAGTGGGAAGAGTTCTAGCTCGAAAGACAATGATGTCAAGATG
rJMSF013C24+ AAACTTGGTTTACAAGCTAGTGGGAAGAGTTCTAGCTCGAAAGACAATGATGTCAAGATG
rJMSF032K03+ AAACTTGGTTTACAAGCTAGTGGGAAGAGTTCTAGCTCGAAAGACAATGATGTCAAGATG
rJMSF032J02+ AAACTTGGTTTACAAGCTAGTGGGAAGAGTTCTAGCTCGAAAGACAATGATGTCAAGATG
rJMSF009G06+ AAACTTGGTTTACAAGCTAGTGGGAAGAGTTCTAGCTCGAAAGACAATGATGTCAAGATG
rJMSF017K04+ AAACTTGGTTTACAAGCTAGTGGGAAGAGTTCTAGCTCGAAAGACAATGATGTCAAGATG
rJMSF034F11+ AAACTTGGTTTACAAGCTAGTGGGAAGAGTTCTAGCTCGAAAGACAATGATGTCAAGATG
rJMSF010M13+ AAACTTGGTTTACAAGCTAGTGGGAAGAGTTCTAGCTCGAAAGACAATGATGTCAAGATG
rJMFF043E03+ AGCTCGAAAGACAATGATGTCAAGATG
                      ____________________________________________________________
consensus AAACTTGGTTTACAAGCTAGTGGGAAGAGTTCTAGCTCGAAAGACAATGATGTCAAGATG
 
. : . : . : . : . : . :
JMFS157A07- ACTGATGCAGTGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
rJMSF013C24+ ACTGATGCAGTGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
rJMSF032K03+ ACTGATGCAGTGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
rJMSF032J02+ ACTGATGCAGNGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
rJMSF009G06+ ACTGATGCAGTGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
rJMSF017K04+ ACTGATGCAGTGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
rJMSF034F11+ ACTGATGCAGTGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
rJMSF010M13+ ACTGATGCAGTGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
rJMFF047L14+ CTCAAAACCAGCACCCCAAGAA
rJMFF043E03+ ACTGATGCAGTGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
                      ____________________________________________________________
consensus ACTGATGCAGTGGAATCATCCAGTGGAAGTGGAGAGTCCTCAAAACCAGCACCCCAAGAA
 
. : . : . : . : . : . :
JMFS157A07- GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
rJMSF013C24+ GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
rJMSF032K03+ GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
rJMSF032J02+ GGTGTTTTNCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
rJMSF009G06+ GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
rJMSF017K04+ GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
rJMSF034F11+ GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
rJMSF010M13+ GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
rJMFF047L14+ GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
rJMFF043E03+ GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
                      ____________________________________________________________
consensus GGTGTTTTGCCCGAGAAGGAACAACACTTGACCGGCATATATGATTTAGTTGCTGTGCTG
 
. : . : . : . : . : . :
JMFS157A07- ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCAAGAAAAT
rJMSF013C24+ ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCAAGAAAAT
rJMSF032K03+ ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCAAGAAAAT
rJMSF032J02+ ACTCACAAGGGAAGAAGTGCAGACTCAGGGCANTACGTTGCCTGGGTCAAGCAAGAAAAT
rJMSF009G06+ ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCAAGAAAAT
rJMSF017K04+ ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCA--AAAAT
rJMSF034F11+ ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCAAGAAAAT
rJMSF010M13+ ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCAAGAAAAT
rJMFF047L14+ ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCAAGAAAAT
rJMFF043E03+ ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCAAGAAAAT
                      ____________________________________________________________
consensus ACTCACAAGGGAAGAAGTGCAGACTCAGGGCACTACGTTGCCTGGGTCAAGCAAGAAAAT
 
. : . : . : . : . : . :
JMFS157A07- GGAAAATGGATTC
rJMSF013C24+ GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
rJMSF032K03+ GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
rJMSF032J02+ GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
rJMSF009G06+ GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
rJMSF017K04+ GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
rJMSF034F11+ GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
rJMSF010M13+ GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
rJMFF047L14+ GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
rJMFF043E03+ GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
                      ____________________________________________________________
consensus GGAAAATGGATTCAATTCGACGATGACAATCCAATACCACAACGCGAGGAAGACATCCCT
 
. : . : . : . : . : . :
rJMSF013C24+ AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
rJMSF032K03+ AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
rJMSF032J02+ AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
rJMSF009G06+ AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
rJMSF017K04+ AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
rJMSF034F11+ AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
rJMSF010M13+ AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
rJMFF047L14+ AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
rJMFF043E03+ AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
                      ____________________________________________________________
consensus AAACTTTCTGGTGGAGGTGACTGGCACATGGCATACATTTGCATGTACAAGGCTCGCGTC
 
. : . : . : . : . : . :
rJMSF013C24+ ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
rJMSF032K03+ ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
rJMSF032J02+ ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
rJMSF009G06+ ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
rJMSF017K04+ ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
rJMSF034F11+ ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
rJMSF010M13+ ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
rJMFF047L14+ ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
rJMFF043E03+ ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
                      ____________________________________________________________
consensus ACCCCCATGTAATATTTTCTCTTGGCATGTTTGGTCATTTGTTGTGTTTACACTACACAT
 
. : . : . : . : . : . :
rJMSF013C24+ TGAGATTGGTCTCTC-TTGAATCTGTTGAGCCGC
rJMSF032K03+ TGAGATTGGTCTCTCTTTGAATCTGTTGAGCCGC
rJMSF032J02+ TGAGATTGGTCTCTCTTTGAATCTGTTGAGCCGCGTGCTACTAGTTTCGG
rJMSF009G06+ TGAGATTGGTCTCTCTTTGAATCTGTTGAGCCGCGTGCTACTAGTTTCGGACTAAATTCT
rJMSF017K04+ TGAGATTGGTCTCTCTTTGAATCTGTTGAGCCGCGTGCTACTAGTTTCGGACTAAATTCT
rJMSF034F11+ TGAGATTGGTCTCTCTTTGAATCTGTTGAGCCGCGTGCTACTAGTTTCGGACTAAATTCT
rJMSF010M13+ TGAGATTGGTCTCTCTTTGAATCTGTTGAGCCGCGTGCTACTAGTTTCGGACTAAATTCT
rJMFF047L14+ TGAGATTGGTCTCTCTTTGAATCTGTTGAGCCGCGTGCTACTAGTTTCGGACTAAATTCT
rJMFF043E03+ TGAGATTGGTCTCTCTTTGAATCTGTTGAGCCGCGTGCTACTAGTTTCGGACTAAATTCT
                      ____________________________________________________________
consensus TGAGATTGGTCTCTCTTTGAATCTGTTGAGCCGCGTGCTACTAGTTTCGGACTAAATTCT
 
. : . : . : . : . : . :
rJMSF009G06+ TAACTTTCGCGATATTGCCATTTGTT-ACTCTGTT
rJMSF017K04+ TAACTTTCGCGATATTGCCATTTGTTAACTCTGTTTA
rJMSF034F11+ TAACTTTCGCGATATTGCCATTTGTT-ACTCTGTTTACTAGCTTTTA
rJMSF010M13+ TAACTTTCGCGATATTGCCATTTGTT-ACTCTGTTTACTAGCTTTTATGATTCTGTCAAA
rJMFF047L14+ TAACTTTCGCGATATTGCCATTTGTT-ACTCTGTTTACTAGCTTTTATGATTCTGTCAAA
rJMFF043E03+ TAACTTTCGCGATATTGCCATTTGTT-ACTCTGTTTACTAGCTTTTATGATTCTGTCAAA
                      ____________________________________________________________
consensus TAACTTTCGCGATATTGCCATTTGTT-ACTCTGTTTACTAGCTTTTATGATTCTGTCAAA
 
. : . : . : . : . : . :
rJMFF047L14+ TGTATGGGAAACTATTTATAGACATCATTCACATATTACAACTTTTACGAGTTCCACTTT
rJMFF043E03+ TGTATGGGAAACTATTTATAGACATCATTCACATATTACAACTTTTACGAGTTCCACTTT
                      ____________________________________________________________
consensus TGTATGGGAAACTATTTATAGACATCATTCACATATTACAACTTTTACGAGTTCCACTTT
 
. : . : . : . : . : . :
rJMFF047L14+ GGCAATGAATGCCATCTACG
rJMFF043E03+ GGCAATGAATGCCATCTACGAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus GGCAATGAATGCCATCTACGAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG