Previous Contig 010292:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF005M20Sequence460005543 (44)sp|P37216|AROG_LYCES2e-21Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5702010292 (36)gb:MCY14797_16858992e-86Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF008N18Sequence538005543 (44)sp|P37216|AROG_LYCES4e-36Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5772010292 (36)gb:MCY14797_16858993e-99Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF008P04Sequence512005543 (44)sp|P37216|AROG_LYCES3e-30Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5775010292 (36)gb:MCY14797_1685899e-100Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF009K03Sequence509005543 (44)sp|P37216|AROG_LYCES1e-29Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5771010292 (36)gb:MCY14797_16858996e-94Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF010K23Sequence337005543 (44)sp|P37216|AROG_LYCES2e-27Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5226010292 (36)gb:MCY14797_16858995e-25Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF014H11Sequence507005543 (44)sp|P37216|AROG_LYCES1e-29Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5752010292 (36)gb:MCY14797_16858992e-96Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF017C07Sequence527005543 (44)sp|P37216|AROG_LYCES8e-34Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5708010292 (36)gb:MCY14797_16858995e-87Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF021F24Sequence510005543 (44)sp|P37216|AROG_LYCES3e-30Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5698010292 (36)gb:MCY14797_16858992e-93Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF022O24Sequence464005543 (44)sp|P37216|AROG_LYCES8e-22Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5780010292 (36)gb:MCY14797_1685899e-101Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF023C23Sequence464005543 (44)sp|P37216|AROG_LYCES8e-22Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5774010292 (36)gb:MCY14797_16858992e-98Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF029F16Sequence528005543 (44)sp|P37216|AROG_LYCES2e-34Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5762010292 (36)gb:MCY14797_16858993e-98Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF030C14Sequence695010292 (36)gb:MCY14797_16858992e-85Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF031E23Sequence511005543 (44)sp|P37216|AROG_LYCES3e-30Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5782010292 (36)gb:MCY14797_1685899e-101Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF031P15Sequence510005543 (44)sp|P37216|AROG_LYCES3e-30Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5753010292 (36)gb:MCY14797_1685899e-100Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF032B24Sequence521005543 (44)sp|P37216|AROG_LYCES3e-32Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5780010292 (36)gb:MCY14797_1685899e-101Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF033A20Sequence528005543 (44)sp|P37216|AROG_LYCES8e-34Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5721010292 (36)gb:MCY14797_16858994e-86Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF036C01Sequence508005543 (44)sp|P37216|AROG_LYCES1e-29Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5761010292 (36)gb:MCY14797_16858994e-94Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF040P22Sequence527005543 (44)sp|P37216|AROG_LYCES8e-34Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5791010292 (36)gb:MCY14797_1685899e-104Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMFF043E02Sequence629005543 (44)sp|P37216|AROG_LYCES3e-52Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5326010292 (36)
JMFF045B02Sequence606005543 (44)sp|P37216|AROG_LYCES5e-50Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5449010292 (36)gb:AP005918_18601093e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P041
JMFF047A09Sequence504005543 (44)sp|P37216|AROG_LYCES3e-29Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5366010292 (36)gb:AP005918_18601092e-26Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P041
JMFF047O04Sequence463005543 (44)sp|P37216|AROG_LYCES8e-22Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5286010292 (36)
JMFF051J19Sequence611005543 (44)sp|P37216|AROG_LYCES2e-44Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5460010292 (36)gb:AP005918_18601096e-33Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P041
JMSF001I19Sequence243005543 (44)737010292 (36)gb:MCY14797_1685899e-100Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF003C12Sequence306005543 (44)743010292 (36)gb:MCY14797_1685899e-100Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF003H09Sequence386005543 (44)pir|T14898|T148982e-10probable 2-dehydro-3-deoxy-phosphoheptonate aldolase (EC 4.1.2.15) 2, chloroplas757010292 (36)gb:MCY14797_16858991e-93Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF003I05Sequence316005543 (44)742010292 (36)gb:MCY14797_16858997e-99Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF013B16Sequence359005543 (44)758010292 (36)gb:MCY14797_1685899e-102Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF015G03Sequence264005543 (44)sp|P37216|AROG_LYCES7e-04Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5741010292 (36)gb:MCY14797_1685899e-100Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF016O06Sequence465005543 (44)sp|P37216|AROG_LYCES8e-22Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5745010292 (36)gb:MCY14797_1685899e-101Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF040D17Sequence658005543 (44)sp|P37216|AROG_LYCES9e-59Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5491010292 (36)gb:MCY14797_16858993e-41Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF044D23Sequence680005543 (44)sp|P37216|AROG_LYCES1e-63Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5745010292 (36)gb:MCY14797_1685899e-100Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF048P19Sequence659005543 (44)sp|P37216|AROG_LYCES9e-59Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5743010292 (36)gb:MCY14797_1685899e-100Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF048P24Sequence660005543 (44)sp|P37216|AROG_LYCES9e-59Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5692010292 (36)gb:MCY14797_16858992e-89Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF049E11Sequence659005543 (44)sp|P37216|AROG_LYCES9e-59Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5710010292 (36)gb:MCY14797_1685899e-101Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase
JMSF050C01Sequence660005543 (44)sp|P37216|AROG_LYCES9e-59Phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplast precursor (EC 2.5.1.5744010292 (36)gb:MCY14797_16858994e-99Morinda citrifolia mRNA for 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF013B16+ TCGTTTGGGCTGGGG
rJMSF003H09+ TCGTTTGGGCT-GGG
rJMFF040P22+ TCTGCCCATTTCGTTTGGGCTGGGG
rJMFF032B24+ TCGTTTGGGCTGGGG
rJMSF016O06+ TTGGGCTGGGG
rJMSF015G03+ GGGCTGGGG
rJMSF050C01+ GGGCTGGGG
rJMSF049E11+ TGGGCTGGGG
rJMFF022O24+ GTTTGGGCTGGGG
rJMFF009K03+ GGG
rJMFF031P15+ GCTGGGG
rJMSF048P19+ GGGG
rJMSF003I05+ GGG
rJMSF044D23+ TGGGG
rJMSF001I19+ TGGGG
rJMFF008P04+ GGCTGGGG
rJMFF023C23+ GGGCTGGGG
rJMFF008N18+ CTGGGG
rJMSF003C12+ GGGG
rJMFF031E23+ CGTTTGGGCTGGGG
                      ____________________________________________________________
consensus TCTGCCCATTTCGTTTGGGCTGGGG
 
. : . : . : . : . : . :
rJMSF013B16+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF003H09+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMFF040P22+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMFF021F24+ TAGATGGTGCCCCATGTTGAGTTCTTGAGGGGAATTGCTAN-CCC
rJMFF036C01+ ACCAGGCAGCTAGATGGTGCCCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMFF033A20+ GAATTGCTAA-CCN
rJMFF032B24+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF016O06+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF015G03+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF050C01+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF049E11+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMFF022O24+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMFF029F16+ ACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMFF009K03+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAACCCC
rJMFF031P15+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF048P19+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF003I05+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF044D23+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF001I19+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF048P24+ TGCTAA-CCC
rJMFF008P04+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMFF023C23+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMFF008N18+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAN-CCC
rJMFF014H11+ CTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMSF003C12+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
rJMFF031E23+ AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
                      ____________________________________________________________
consensus AGCGTACCAGGCAGCTAGATGGTG-CCCATGTTGAGTTCTTGAGGGGAATTGCTAA-CCC
 
. : . : . : . : . : . :
rJMSF013B16+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF003H09+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF040P22+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF021F24+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF036C01+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF033A20+ TCTCGGGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF032B24+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF016O06+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF015G03+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF050C01+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF049E11+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF022O24+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF029F16+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF009K03+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF031P15+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF048P19+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF003I05+ TCTC-GGGATTAAGGTGAGTGATGAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF044D23+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF001I19+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF048P24+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF008P04+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF023C23+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF008N18+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF014H11+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMSF003C12+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF005M20+ GATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF030C14+ GGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF031E23+ TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
rJMFF017C07+ GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
                      ____________________________________________________________
consensus TCTC-GGGATTAAGGTGAGTGATAAGATGAATCCGGATGAGCTAGTCAAGCTCATTGAGA
 
. : . : . : . : . : . :
rJMSF013B16+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF003H09+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF040P22+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF021F24+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF036C01+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF033A20+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF032B24+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF016O06+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF015G03+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF050C01+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF049E11+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF022O24+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF029F16+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF009K03+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF031P15+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF048P19+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF003I05+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF044D23+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF001I19+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF048P24+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF008P04+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF023C23+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF008N18+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF014H11+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMSF003C12+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF005M20+ TTTTGAACCCTCAGAACAAACNTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF030C14+ TTTTGAACCCTCAGAACAAACNTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF031E23+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
rJMFF017C07+ TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
                      ____________________________________________________________
consensus TTTTGAACCCTCAGAACAAACCTGGGAGGATCACAGTAATTACAAGAATGGGAGCAGAAA
 
. : . : . : . : . : . :
rJMSF013B16+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF003H09+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF040P22+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF021F24+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF036C01+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF033A20+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF032B24+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF016O06+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF015G03+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF050C01+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF049E11+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF022O24+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF029F16+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF009K03+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF031P15+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF048P19+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF003I05+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF044D23+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF001I19+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF048P24+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF008P04+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF023C23+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGACCCGGGCAAATTGTGA
rJMFF008N18+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF014H11+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMSF003C12+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF005M20+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF030C14+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF031E23+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
rJMFF017C07+ ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
                      ____________________________________________________________
consensus ACATGAGGGTTAAGCTTCCTCATTTAATCAGGGCAGTCCGAAGAGCCGGGCAAATTGTGA
 
. : . : . : . : . : . :
rJMSF013B16+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF003H09+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF040P22+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF021F24+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF036C01+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF033A20+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF032B24+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF016O06+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF015G03+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF050C01+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF049E11+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF022O24+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF029F16+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF009K03+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF031P15+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF048P19+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF003I05+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF044D23+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF001I19+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF048P24+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF008P04+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF023C23+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF008N18+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF014H11+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF003C12+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMSF040D17+ GTTTNTGATCNTANGCATGGAAACNC-TATTAAAGCTCCNTGCGGTNTTAAGACT
rJMFF010K23+ TATGCANGGAAACACNTATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF005M20+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF030C14+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF031E23+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
rJMFF017C07+ CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
                      ____________________________________________________________
consensus CTTGGGTTTCTGATCCTATGCATGGAAACAC-TATTAAAGCTCCCTGCGGTCTTAAGACT
 
. : . : . : . : . : . :
rJMSF013B16+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF003H09+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF040P22+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF021F24+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF036C01+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF033A20+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGG
rJMFF032B24+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF016O06+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF015G03+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF050C01+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF049E11+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF022O24+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF029F16+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF009K03+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGG
rJMFF031P15+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF048P19+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF003I05+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF044D23+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF001I19+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF048P24+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF008P04+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF023C23+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATTAGCAAGA
rJMFF008N18+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF014H11+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF003C12+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMSF040D17+ N-GACCCTTNGATTCTATCAGNGCTGAANTGAGAGCGTTNTTCGANGTGCATGAGCAAGA
rJMFF010K23+ CGGACCCTTTGATTNTATCAGGGATGAAGTGAGAGCGTTNTTCGATGTGCATGAGCAAGA
rJMFF005M20+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF030C14+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF031E23+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF017C07+ C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
rJMFF045B02+ TTCGATGTGCATGAGCAAGA
rJMFF051J19+ GAGCAAGA
                      ____________________________________________________________
consensus C-GACCCTTTGATTCTATCAGGGCTGAAGTGAGAGCGTTCTTCGATGTGCATGAGCAAGA
 
. : . : . : . : . : . :
rJMSF013B16+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF003H09+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF040P22+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF021F24+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF036C01+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF033A20+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF032B24+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF016O06+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF015G03+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF050C01+ AGGAAGCCACCCAGGACGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF049E11+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF022O24+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF029F16+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF009K03+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF031P15+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF048P19+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF003I05+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF044D23+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF001I19+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF048P24+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF008P04+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF023C23+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF008N18+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF014H11+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF003C12+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF047A09+ GCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMSF040D17+ AGGAAGCCACCCNGGAGGTGTGCNCTTAGAGATGANGGGCCANAACGTGACAGAGTNCAN
rJMFF010K23+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGNNNCAGAGTGCAT
rJMFF005M20+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF030C14+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF031E23+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF017C07+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF045B02+ AGGAAGCCCCCCGGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
rJMFF051J19+ AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
                      ____________________________________________________________
consensus AGGAAGCCACCCAGGAGGTGTGCACTTAGAGATGACGGGCCAAAACGTGACAGAGTGCAT
 
. : . : . : . : . : . :
rJMSF013B16+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCTGCTACCACACCCACTGTGA
rJMSF003H09+ TGGTGGATCACGAAC--TGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF040P22+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF021F24+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF036C01+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF033A20+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF032B24+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF016O06+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF015G03+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF050C01+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF049E11+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF022O24+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF029F16+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF009K03+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF031P15+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF048P19+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF003I05+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF044D23+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF001I19+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF048P24+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF008P04+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF023C23+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF008N18+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF014H11+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF003C12+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF047A09+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMSF040D17+ TGGTGGATCACGAACTGTGACTTTNGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF010K23+ TGGNGGATCAGGAACTGTGACTTTTGACGATCTGGGTTCCCGATACCACACCC
rJMFF005M20+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF030C14+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF031E23+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF017C07+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
rJMFF045B02+ TGGTGGATCACGAACTGTGACTTTTGACGATTTGGGTTCCCGTTACCACACCCACTGTGA
rJMFF051J19+ TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
                      ____________________________________________________________
consensus TGGTGGATCACGAACTGTGACTTTTGACGATCTGGGTTCCCGCTACCACACCCACTGTGA
 
. : . : . : . : . : . :
rJMSF013B16+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF003H09+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF040P22+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF021F24+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF036C01+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF033A20+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF032B24+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF016O06+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF015G03+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF050C01+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF049E11+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF022O24+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF029F16+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF009K03+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF031P15+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF048P19+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF003I05+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF044D23+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF001I19+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF048P24+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF008P04+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF023C23+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF008N18+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF014H11+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF003C12+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF047A09+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMSF040D17+ CCCTAGGCTGAACGCCTNTCAGTCCCTCGAGCTTGCATTCATCANTGCGGAGCNCTTGAG
rJMFF005M20+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF030C14+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF031E23+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF017C07+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF045B02+ CCTTAGGGTGAACGCCTCTCAGTCCCTGGAGCTTGCATTCATCATTGGGGAGCGCTTGAG
rJMFF047O04+ AGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF051J19+ CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
rJMFF043E02+ AGCTTGCATTCATCATTGCGGAGCGCTTGAG
                      ____________________________________________________________
consensus CCCTAGGCTGAACGCCTCTCAGTCCCTCGAGCTTGCATTCATCATTGCGGAGCGCTTGAG
 
. : . : . : . : . : . :
rJMSF013B16+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF003H09+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF040P22+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF021F24+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF036C01+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF033A20+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF032B24+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF016O06+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF015G03+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF050C01+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF049E11+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF022O24+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF029F16+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF009K03+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF031P15+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF048P19+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF003I05+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF044D23+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF001I19+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF048P24+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF008P04+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF023C23+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF008N18+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF014H11+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF003C12+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF047A09+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMSF040D17+ AAAGAGGAGAATTGGAAGCACATCANTACTGTAGAGAGGGTGTTNGAGGNTGCTGTCNTN
rJMFF005M20+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF030C14+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF031E23+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF017C07+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF045B02+ AAAGAGGAGAATTGGAAGCCCATCAGGCCTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF047O04+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF051J19+ AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
rJMFF043E02+ AAAGAGGAGAATTGGAAGCCCATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
                      ____________________________________________________________
consensus AAAGAGGAGAATTGGAAGCACATCAGGACTGTAGAGAGGGTGTTTGAGGTTGCTGTCTTT
 
. : . : . : . : . : . :
rJMSF013B16+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF003H09+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF040P22+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF021F24+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF036C01+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF033A20+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF032B24+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF016O06+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF015G03+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF050C01+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF049E11+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF022O24+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF029F16+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF009K03+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF031P15+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF048P19+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF003I05+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF044D23+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF001I19+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF048P24+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF008P04+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF023C23+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF008N18+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF014H11+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF003C12+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF047A09+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMSF040D17+ TGTTTTNGTCCCCNTTCGTNTTCCTTAAACTATGGTTGGNTGTATTAATACGCGCTTAGC
rJMFF005M20+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF030C14+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF031E23+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF017C07+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF045B02+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTGGGTTGTATTAATACGCGCTTAGG
rJMFF047O04+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF051J19+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
rJMFF043E02+ TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
                      ____________________________________________________________
consensus TGTTTTTGTCCCCTTTCGTTTTCCTTAAACTATGGTTGGTTGTATTAATACGCGCTTAGG
 
. : . : . : . : . : . :
rJMSF013B16+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF003H09+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF040P22+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF021F24+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF036C01+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF033A20+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF032B24+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF016O06+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF015G03+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF050C01+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF049E11+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-A
rJMFF022O24+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF029F16+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF009K03+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF031P15+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF048P19+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF003I05+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF044D23+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGACATA
rJMSF001I19+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF048P24+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF008P04+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF023C23+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF008N18+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF014H11+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF003C12+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF047A09+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMSF040D17+ TTTGATGACATCCANGTCTAGATTATGTTGTGAGCTACTTGTGCATAACTGCAAGA-ATA
rJMFF005M20+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF030C14+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF031E23+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF017C07+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF045B02+ TTTGATGCCC-CCATGTTTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTCCAAGA-ATA
rJMFF047O04+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF051J19+ TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
rJMFF043E02+ TTTGATGACA-CCATGTTTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
                      ____________________________________________________________
consensus TTTGATGACA-CCATGTCTAGATTATGTTGTGAGCTA-TTGTGCAT-ACTGCAAGA-ATA
 
. : . : . : . : . : . :
rJMSF013B16+ TGTTGTATGAGAGTT-CCGGCATTTCGCT
rJMSF003H09+ TGTTGTATGAGAGTTCCCGGCATTTCGCT
rJMFF040P22+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAA-AAAGAAA
rJMFF021F24+ T
rJMFF036C01+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTA-GAA-GAA-AAAGAAA
rJMFF033A20+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTA-GAA-GAA-AAAGAAA
rJMFF032B24+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTA-GAA-GAA-AAAGAAA
rJMSF016O06+ TGTTGTATGAGAGTT-CCGGCATT
rJMSF015G03+ TGTTGTATGAGAGTT-CCGGCA
rJMSF050C01+ TGTTGTATGAGAGTT-CCGGCATTT
rJMFF022O24+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAATAAAGAAA
rJMFF029F16+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAATAAAGAAA
rJMFF009K03+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAATAAAGAAA
rJMFF031P15+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATG
rJMSF048P19+ TGTTGTATGAGAGTT-CCGGCATTTCGCT
rJMSF003I05+ TGTTGTATGAGAGTT-CCGGCATTTCGCT
rJMSF044D23+ TGTTGTATGAGAGTT-CCGGCATTTCGCT
rJMSF001I19+ TGTTGTATGAGAGTT-CCGGCA
rJMSF048P24+ TGTTGTATGAGAGTT-CCGGCATTTCGCT
rJMFF008P04+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAATAAAGAAA
rJMFF023C23+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTA-GAA-GAA-AAAGAAA
rJMFF008N18+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAA-NAAGAAA
rJMFF014H11+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAA-AAAGAAA
rJMSF003C12+ TGTTGTATGAGAGTT-CCGGCATTTCGCT
rJMFF047A09+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCC
rJMSF040D17+ TGTCGTATGNGAGTT-CCGG
rJMFF005M20+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAA-AAAGAAA
rJMFF030C14+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTA-GAA-GAA-AAAGAAA
rJMFF031E23+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAATAAAGAAAA
rJMFF017C07+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAATAAAGAAAAT
rJMFF045B02+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTAGGAAGGAATAAAGAAAAT
rJMFF047O04+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAATGAATAAAGAAAAT
rJMFF051J19+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAATGAATAAAGAAAAT
rJMFF043E02+ TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAATGAATAAAGAAAAT
                      ____________________________________________________________
consensus TGTTGTATGAGAGTT-CCGGCATTTCGCTTCCTATGTGACTATGAA-GAATAAAGAAAAT
 
. : . : . : . : . : . :
rJMFF017C07+ T
rJMFF045B02+ TTTGCTTGCGC
rJMFF047O04+ TTTGCTTGCGC
rJMFF051J19+ TTTGCTTGCGC
rJMFF043E02+ TTTGCTTGCGCXXXXXXXXXXXXXXXXXXXXXXXTAAAAAAAAAAAAAAAACTCTCCAGG
                      ____________________________________________________________
consensus TTTGCTTGCGCNNNNNNNNNNNNNNNNNNNNNNNTAAAAAAAAAAAAAAAACTCTCCAGG