Previous Contig 010287:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF001M01Sequence625010287 (10)gb:AY087973_15729972e-56Arabidopsis thaliana clone 40058 mRNA, complete sequence.754010287 (10)gb:AY087973_15729976e-74Arabidopsis thaliana clone 40058 mRNA, complete sequence.
JMFF043D06Sequence619010287 (10)gb:AY087973_15729972e-58Arabidopsis thaliana clone 40058 mRNA, complete sequence.568010287 (10)gb:AY087973_15729972e-25Arabidopsis thaliana clone 40058 mRNA, complete sequence.
JMFF043F04Sequence463010287 (10)gb:AY087973_15729979e-50Arabidopsis thaliana clone 40058 mRNA, complete sequence.328010287 (10)
JMSF025O18Sequence635010287 (10)gb:AY087973_15729975e-62Arabidopsis thaliana clone 40058 mRNA, complete sequence.715010287 (10)gb:AY087973_15729972e-71Arabidopsis thaliana clone 40058 mRNA, complete sequence.
JMSF040B06Sequence689010287 (10)gb:AY087973_15729971e-70Arabidopsis thaliana clone 40058 mRNA, complete sequence.798010287 (10)gb:AY087973_15729975e-76Arabidopsis thaliana clone 40058 mRNA, complete sequence.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF001M01- ATCATA
                      ____________________________________________________________
consensus ATCATA
 
. : . : . : . : . : . :
JMFF001M01- ACTGTAGTTCACAGTTGAGACTGAAGATGACAACACTTTCAACGCCGACGACGGTGAATT
JMFF043D06- GACAACACTTTCAACGCCGACGACGGTGAATT
JMSF025O18- GACAACACTTTCAACGCCGACGACGGTGAATT
JMSF040B06- GACAACACTTTCAACGCCGACGACGGTGAATT
                      ____________________________________________________________
consensus ACTGTAGTTCACAGTTGAGACTGAAGATGACAACACTTTCAACGCCGACGACGGTGAATT
 
. : . : . : . : . : . :
JMFF001M01- TAGAAGAATTGTCAATGTCGGCGCCCGGAGCTCACAAAACGGTGCTGATAACCGGCGTGA
JMFF043D06- TAGAAGAATTGTCAATGTCGGCGCCCGGAGCTCACAAAACGGTGCTGATAACCGGCGTGA
JMSF025O18- TAGAAGAATTGTCAATGTCGGCGCCCGGAGCTCACAAAACGGTGCTGATAACCGGCGTGA
JMSF040B06- TAGAAGAATTGTCAATGTCGGCGCCCGGAGCTCACAAAACGGTGCTGATAACCGGCGTGA
                      ____________________________________________________________
consensus TAGAAGAATTGTCAATGTCGGCGCCCGGAGCTCACAAAACGGTGCTGATAACCGGCGTGA
 
. : . : . : . : . : . :
JMFF001M01- GCCGGGGGCTGGGCAAAGCTCTAGCCCTAGAATTGGCGAAGAGAGGTCACACCATAATCG
JMFF043F04- GGGGACTGGGCAAAGCTCTAGCCCTAGAATTGGCGAAGAGAGGTCACACCATAATCG
JMFF043D06- GCCGGGGGCTGGGCAAAGCTCTAGCCCTAGAATTGGCGAAGAGAGGTCACACCATAATCG
JMSF025O18- GCCGGGGGCTGGGCAAAGCTCTAGCCCTAGAATTGGCGAAGAGAGGTCACACCATAATCG
JMSF040B06- GCCGGGGGCTGGGCAAAGCTCTAGCCCTAGAATTGGCGAAGAGAGGTCACACCATAATCG
                      ____________________________________________________________
consensus GCCGGGGGCTGGGCAAAGCTCTAGCCCTAGAATTGGCGAAGAGAGGTCACACCATAATCG
 
. : . : . : . : . : . :
JMFF001M01- GCTGCTCTCGTTCCCAGGATAAGCTCAATTCTCTTCATGCCGAGCTCGCATCCGCCTCCA
JMFF043F04- GCTGCTCTCGTTCCCAGGATAAACTCAAATCTCTTCATGGCGAGCTCGCATCCGCCTCCA
JMFF043D06- GCTGCTCTCGTTCCCAGGATAAGCTCAATTCTCTTCATGCCGAGCTCGCATCCGCCTCCA
JMSF025O18- GCTGCTCTCGTTCCCAGGATAAGCTCAATTCTCTTCATGCCGAGCTCGCATCCGCCTCCA
JMSF040B06- GCTGCTCTCGTTCCCAGGATAAGCTCAATTCTCTTCATGCCGAGCTCGCATCCGCCTCCA
                      ____________________________________________________________
consensus GCTGCTCTCGTTCCCAGGATAAGCTCAATTCTCTTCATGCCGAGCTCGCATCCGCCTCCA
 
. : . : . : . : . : . :
JMFF001M01- GTTCCACATCTTCTTCCCAAAACAAACACCTCATCATGAAAGTTGATGTGAGGTCAAATA
JMFF043F04- GTTCCACATCTTCTTCCCAAAACAAACACCTCATCATGAAAGATGATGTGAGGTCAAATA
JMFF043D06- GTTCCACATCTTCTTCCCAAAACAAACACCTCATCATGAAAGTTGATGTGAGGTCAAATA
JMSF025O18- GTTCCACATCTTCTTCCCAAAACAAACACCTCATCATGAAAGTTGATGTGAGGTCAAATA
JMSF040B06- GTTCCACATCTTCTTCCCAAAACAAACACCTCATCATGAAAGTTGATGTGAGGTCAAATA
rJMSF025O18+ TA
rJMFF001M01+ ATGAAAGTTGATGTGAGGTCAAATA
rJMSF040B06+ CTTCCCAAAACAAACACCTCATCATGAAAGTTGATGTGAGGTCAAATA
                      ____________________________________________________________
consensus GTTCCACATCTTCTTCCCAAAACAAACACCTCATCATGAAAGTTGATGTGAGGTCAAATA
 
. : . : . : . : . : . :
JMFF001M01- GCAGTGTTGAAGAATTGGCACATGCTGTTATGGAGAATAAGAGCATTCCTGATATTGTAG
JMFF043F04- GCAGCGCTGAAGAATTGGCACATGCTGTTATGGAGAATAAGAGCATTCCTGATATTGTAG
JMFF043D06- GCAGTGTTGAAGAATTGGCACATGCTGTTATGGAGAATAAGAGCATTCCTGATATTGTAG
JMSF025O18- GCAGTGTTGAAGAATTGGCACATGCTGTTATGGAGAATAAGAGCATTCCTGATATTGTAG
JMSF040B06- GCAGTGTTGAAGAATTGGCACATGCTGTTATGGAGAATAAGAGCATTCCTGATATTGTAG
rJMSF025O18+ GCAGTGTTGAAGAATTGGCACATGCTGTTATGGAGAATAAGAGCATTCCTGATATTGTAG
rJMFF001M01+ GCAGTGTTGAAGAATTGGCACATGCTGTTATGGAGAATAAGAGCATTCCTGATATTGTAG
rJMSF040B06+ GCAGTGTTGAAGAATTGGCACATGCTGTTATGGAGAATAAGAGCATTCCTGATATTGTAG
                      ____________________________________________________________
consensus GCAGTGTTGAAGAATTGGCACATGCTGTTATGGAGAATAAGAGCATTCCTGATATTGTAG
 
. : . : . : . : . : . :
JMFF001M01- TTAACAATGCAGGAACCATTAATAGGAACAACAGGCTCTGGGAGGTCCCAGCAGAGGACT
JMFF043F04- TTAACAATGCAGGAACCATTAATAGGAACAACAGGCTCTGGGAGGTCCCAGCAGAGGACT
JMFF043D06- TTAACAATGCAGGAACCATTAATAGGAACAACAGGCTCTGGGAGGTCCCAGCAGAGGACT
JMSF025O18- TTAACAATGCAGGAACCATTAATAGGAACAACAGGCTCTGGGAGGTCCCAGCAGAGGACT
JMSF040B06- TTAACAATGCAGGAACCATTAATAGGAACAACAGGCTCTGGGAGGTCCCAGCAGAGGACT
rJMSF025O18+ TTAACAATGCAGGAACCATTAATAGGAACAACAGGCTCTGGGAGGTCCCAGCAGAGGACT
rJMFF001M01+ TTAACAATGCAGGAACCATTAATAGGAACAACAGGCTCTGGGAGGTCCCAGCAGAGGACT
rJMSF040B06+ TTAACAATGCAGGAACCATTAATAGGAACAACAGGCTCTGGGAGGTCCCAGCAGAGGACT
                      ____________________________________________________________
consensus TTAACAATGCAGGAACCATTAATAGGAACAACAGGCTCTGGGAGGTCCCAGCAGAGGACT
 
. : . : . : . : . : . :
JMFF001M01- TTGATAATGTTATTGATACAAATGTGAAAGGAGTAGCAAATGTGCTGCGCCACTTCATTC
JMFF043F04- TTGATAATGTTATTGATACAAATGTGAAAGGAGTAGCAAATGTGCTGCGCCACTTCATTC
JMFF043D06- TTGATAATGTTATTGATACAAATGTGAAAGGAGTAGCAAATGTGCTGCGCCACTTCATTC
JMSF025O18- TTGATAATGTTATTGATACAAATGTGAAAGGAGTAGCAAATGTGCTGCGCCACTTCATTC
JMSF040B06- TTGATAATGTTATTGATACAAATGTGAAAGGAGTAGCAAATGTGCTGCGCCACTTCATTC
rJMSF025O18+ TTGATAATGTTATTGATACAAATGTGAAAGGAGTAGCAAATGTGCTGCGCCACTTCATTC
rJMFF001M01+ TTGATAATGTTATTGATACAAATGTGAAAGGAGTAGCAAATGTGCTGCGCCACTTCATTC
rJMSF040B06+ TTGATAATGTTATTGATACAAATGTGAAAGGAGTAGCAAATGTGCTGCGCCACTTCATTC
                      ____________________________________________________________
consensus TTGATAATGTTATTGATACAAATGTGAAAGGAGTAGCAAATGTGCTGCGCCACTTCATTC
 
. : . : . : . : . : . :
JMFF001M01- CACTTATGATTGACAAGAAGCAAGGAATTATTGTTAATTTGTCTTCAGGATGGGGAAGAT
JMFF043F04- CACTTATGATTGACAAGAAGTAAGGAATTATTGCTAATTTGTCTTCAGGATGGGGAAGAT
JMFF043D06- CACTTATGATTGACAAGAAGTAAGGAATTATTGTTAATTTGTCTTCAGGATGGGGAAGAT
JMSF025O18- CACTTATGATTGACAAGAAGCAAGGAATTATTGTTAATTTGTCTTCAGGATGGGGAAGAT
JMSF040B06- CACTTATGATTGACAAGAAGCAAGGAATTATTGTTAATTTGTCTTCAGGATGGGGAAGAT
rJMSF025O18+ CACTTATGATTGACAAGAAGCAAGGAATTATTGTTAATTTGTCTTCAGGATGGGGAAGAT
rJMFF001M01+ CACTTATGATTGACAAGAAGCAAGGAATTATTGTTAATTTGTCTTCAGGATGGGGAAGAT
rJMSF040B06+ CACTTATGATTGACAAGAAGCAAGGAATTATTGTTAATTTGTCTTCAGGATGGGGAAGAT
                      ____________________________________________________________
consensus CACTTATGATTGACAAGAAGCAAGGAATTATTGTTAATTTGTCTTCAGGATGGGGAAGAT
 
. : . : . : . : . : . :
JMFF001M01- CAGCAGCTGCACAGGTAGCACCATATTGTGCTTCCAAGTGGGCTATAGAGGGTCTGACAA
JMFF043F04- CAGCAGCTGCACAGGTAGCACCATATTGTGCTTTCAAGTGGGCTAT
JMFF043D06- CAGCAGCTGCACAGGTAGCACCATATTGTGCTTCCAAGTGGGCTATAGAGGGTCTGNACA
JMSF025O18- CAGCAGCTGCACAGGTAGCACCATATTGTGCTTCCAAGTGGGCTATAGAGGGTCTGACAA
JMSF040B06- CAGCAGCTGCACAGGTAGCACCATATTGTGCTTCCAAGTGGGCTATAGAGGGTCTGACAA
rJMSF025O18+ CAGCAGCTGCACAGGTAGCACCATATTGTGCTTCCAAGTGGGCTATAGAGGGTCTGACAA
rJMFF001M01+ CAGCAGCTGCACAGGTAGCACCATATTGTGCTTCCAAGTGGGCTATAGAGGGTCTGACAA
rJMSF040B06+ CAGCAGCTGCACAGGTAGCACCATATTGTGCTTCCAAGTGGGCTATAGAGGGTCTGACAA
rJMFF043D06+ TCCAAGTGGGCTATAGAGGGTCTGACAA
                      ____________________________________________________________
consensus CAGCAGCTGCACAGGTAGCACCATATTGTGCTTCCAAGTGGGCTATAGAGGGTCTGACAA
 
. : . : . : . : . : . :
JMFF001M01- AATCAATAGCTAAGGAGAT
JMFF043D06- AATCAATAGCTAAGGAGATACCAACTGGAATTGCAGTTGTTGCTCTT
JMSF025O18- AATCAATAGCTAAGGAGATACCAACTGGAATTGCAGTTGTTGCTCTTAGCCCTGGTGTTA
JMSF040B06- AATCAATAGCTAAGGAGATACCAACTGGAATTGCAGTTGTTGCTCTTAGCCCTGGTGTTA
rJMSF025O18+ AATCAATAGCTAAGGAGATACCAACTGGAATTGCAGTTGTTGCTCTTAGCCCTGGTGTTA
rJMFF001M01+ AATCAATAGCTAAGGAGATACCAACTGGAATTGCAGTTGTTGCTCTTAGCCCTGGTGTTA
rJMSF040B06+ AATCAATAGCTAAGGAGATACCAACTGGAATTGCAGTTGTTGCTCTTAGCCCTGGTGTTA
rJMFF043D06+ AATCAATAGCTAAGGAGATACCAACTGGAATTGCAGTTGTTGCTCTTAGCCCTGGTGTTA
                      ____________________________________________________________
consensus AATCAATAGCTAAGGAGATACCAACTGGAATTGCAGTTGTTGCTCTTAGCCCTGGTGTTA
 
. : . : . : . : . : . :
JMSF025O18- TT
JMSF040B06- TTAACACTGAGATGCTTCAATCATGCTTTGGCAGTTCAGCTTCACTCTACCAG
rJMSF025O18+ TTAACACTGAGATGCTTCAATCATGCTTTGGCAGTTCAGCTTCACTCTACCAGGCACCAG
rJMFF001M01+ TTAACACTGAGATGCTTCAATCATGCTTTGGCAGTTCAGCTTCACTCTACCAGGCACCAG
rJMSF040B06+ TTAACACTGAGATGCTTCAATCATGCTTTGGCAGTTCAGCTTCACTCTACCAGGCACCAG
rJMFF043D06+ TTAACACTGAGATGCTTCAATCATGCTTTGGCAGTTCAGCTTCACTCTACCAGGCACCAG
                      ____________________________________________________________
consensus TTAACACTGAGATGCTTCAATCATGCTTTGGCAGTTCAGCTTCACTCTACCAGGCACCAG
 
. : . : . : . : . : . :
rJMSF025O18+ AGTCTTGGGCTCCAAAAGCAGCTACAATGATACTTAATCTTACGGTGGCTGACAATGGTT
rJMFF001M01+ AGTCTTGGGCTCCAAAAGCAGCTACAATGATACTTAATCTTACGGTGGCTGACAATGGTT
rJMSF040B06+ AGTCTTGGGCTCCAAAAGCAGCTACAATGATACTTAATCTTACGGTGGCTGACAATGGTT
rJMFF043F04+ CAATGGTT
rJMFF043D06+ AGTCTTGGGCTCCAAAAGCAGCTACAATGATACTTAATCTTACGGTGGCTGACAATGGTT
                      ____________________________________________________________
consensus AGTCTTGGGCTCCAAAAGCAGCTACAATGATACTTAATCTTACGGTGGCTGACAATGGTT
 
. : . : . : . : . : . :
rJMSF025O18+ TATCTCTTACGGTGTGAAACATGCACCACCAAAGCAACATGATAGCATTAGTTTGTGCAG
rJMFF001M01+ TATCTCTTACGGTGTGAAACATGCACCACCAAAGCAACATGATAGCATTAGTTTGTGCAG
rJMSF040B06+ TATCTCTTACGGTGTGAAACATGCACCACCAAAGCAACATGATAGCATTAGTTTGTGCAG
rJMFF043F04+ TATCTCTTACGGTGTGAAACATGCGCCACCAAAGCAACATGATAGCATTAGTTTGTGCAG
rJMFF043D06+ TATCTCTTACGGTGTGAAACATGCACCACCAAAGCAACATGATAGCATTAGTTTGTGCAG
                      ____________________________________________________________
consensus TATCTCTTACGGTGTGAAACATGCACCACCAAAGCAACATGATAGCATTAGTTTGTGCAG
 
. : . : . : . : . : . :
rJMSF025O18+ ATGCCATTTTAACCAGATTTGTCTAATCTAGCAGTTTAGGATTTTTCAGAATTACTTTAA
rJMFF001M01+ ATGCCATTTTAACCAGATTTGTCTAATCTAGCAGTTTAGGATTTTTCAGAATTACTTTAA
rJMSF040B06+ ATGCCATTTTAACCAGATTTGTCTAATCTAGCAGTTTAGGATTTTTCAGAATTACTTTAA
rJMFF043F04+ ATGCCATTTTAACCAGATTTGTATAATATAGCAGTTTAGGATTTTTCAGAATTACTTTAA
rJMFF043D06+ ATGCCATTTTAACCAGATTTGTCTAATCTAGCAGTTTAGGATTTTTCAGAATTACTTTAA
                      ____________________________________________________________
consensus ATGCCATTTTAACCAGATTTGTCTAATCTAGCAGTTTAGGATTTTTCAGAATTACTTTAA
 
. : . : . : . : . : . :
rJMSF025O18+ TCTTGTATGAGCCAGTCAAAGCACCTGAAGGTGATGATATTACTAGGCAATGAAGAGGAA
rJMFF001M01+ TCTTGTATGAGCCAGTCAAAGCACCTGAAGGTGATGATATTACTAGGCAATGAAGAGGAA
rJMSF040B06+ TCTTGTATGAGCCAGTCAAAGCACCTGAAGGTGATGATATTACTAGGCAATGAAGAGGAA
rJMFF043F04+ TCTTGTATGAGCCAGTCAAAGCACCTGAAGGTGATGATATTATTAGGCAATGAAGAGGAA
rJMFF043D06+ TCTTGTATGAGCCAGTCAAAGCACCTGAAGGTGATGATATTACTAGGCAATGAAGAGGAA
                      ____________________________________________________________
consensus TCTTGTATGAGCCAGTCAAAGCACCTGAAGGTGATGATATTACTAGGCAATGAAGAGGAA
 
. : . : . : . : . : . :
rJMSF025O18+ ATGTTGAAAATTAAGAGGATACATGATGTATTATCTCACATTGGATTCATTGT
rJMFF001M01+ ATGTTGAAAATTAAGAGGATACATGATGTATTATCTCACATTGGATTCATTG-TGGATCT
rJMSF040B06+ ATGTTGAAAATTAAGAGGATACATGATGTATTATCTCACATTGGATTCATTGTTGGATCT
rJMFF043F04+ ATGTTGAAAATTAAGAGGATACATGATGTATTATCTCACATCGGATTCATTGTTGGATCT
rJMFF043D06+ ATGTTGAAAATTAAGAGGATACATGATGTATTATCTCACATTGGATTCATTGTTGGATCT
                      ____________________________________________________________
consensus ATGTTGAAAATTAAGAGGATACATGATGTATTATCTCACATTGGATTCATTGTTGGATCT
 
. : . : . : . : . : . :
rJMFF001M01+ CATAAGCTCA
rJMSF040B06+ CATAAGCTCATGAAATTTACTATTTGCCTC
rJMFF043F04+ CATAAGCTCATGAAATTTACTATTTGCCTCTTTGGCTGTTTGGTCTGCAGAAAAATGAAA
rJMFF043D06+ CATAAGCTCATGAAATTTACTATTTGCCTCTTTGGCTGTTTGGTCTACAGAAAAATGAAA
                      ____________________________________________________________
consensus CATAAGCTCATGAAATTTACTATTTGCCTCTTTGGCTGTTTGGTCTGCAGAAAAATGAAA
 
. : . : . : . : . : . :
rJMFF043F04+ CGACAAACATATTTATGAGC
rJMFF043D06+ CGACAAACATATTTATGAGCAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus CGACAAACATATTTATGAGCAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG