Previous Contig 010278:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF014M09Sequence590010278 (6)pir|JN0505|JN05058e-95protein kinase (EC 2.7.1.37) 5 - Arabidopsis thaliana>gb:AB016886_1513133 Arabid725010278 (6)gb:AP005761_18574152e-70Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:B106
JMFF043B22Sequence620001836 (2)593010278 (6)gb:AP004620_18422008e-56Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P060
JMFF049N16Sequence600010278 (6)pir|JN0505|JN05052e-96protein kinase (EC 2.7.1.37) 5 - Arabidopsis thaliana>gb:AB016886_1513133 Arabid557010278 (6)gb:AP004620_18422002e-61Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P060
JMSF026G03Sequence634001836 (2)718010278 (6)pir|T08927|T089272e-83probable protein kinase T15N24.60 (EC 2.7.1.-) - Arabidopsis thaliana>gb:ATCHRIV

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF014M09- AACCGAAAGAAATTGCTCCGTGCTCAAACAGAAAGAGAGATAC
JMFF049N16- GGGCGAACCGAAAGAAATTGCTCCGTGCTCAAACAGAAAGAGAGATAC
                      ____________________________________________________________
consensus GGGCGAACCGAAAGAAATTGCTCCGTGCTCAAACAGAAAGAGAGATAC
 
. : . : . : . : . : . :
JMFF014M09- TTCAATCTCTCGACCATCCGTTTCTTCCAAGTTTATATACCCATTTCGAGACAGAAAGGT
JMFF049N16- TTCAATCTCTCGACCATCCGTTTCTTCCAAGTTTATATACCCATTTCGAGACAGAAAGGT
                      ____________________________________________________________
consensus TTCAATCTCTCGACCATCCGTTTCTTCCAAGTTTATATACCCATTTCGAGACAGAAAGGT
 
. : . : . : . : . : . :
JMFF014M09- TTTCGTGTCTCGTGATGGAGTTTTGTCCGGGAGGAGACTTGCACACACTTCGCCAGAGGC
JMFF049N16- TTTCGTGTCTCGTGATGGAGTTTTGTCCGGGAGGAGACTTGCACACACTTCGCCAGAGGC
                      ____________________________________________________________
consensus TTTCGTGTCTCGTGATGGAGTTTTGTCCGGGAGGAGACTTGCACACACTTCGCCAGAGGC
 
. : . : . : . : . : . :
JMFF014M09- AACCGGGAAAGCATTTTTCTGAACAAGCAGTGAAGTTCTATGTTGCAGAGGTCCTTCTTG
JMFF049N16- AACCGGGAAAGCATTTTTCTGAACAAGCAGTGAAGTTCTATGTTGCAGAGGTCCTTCTTG
                      ____________________________________________________________
consensus AACCGGGAAAGCATTTTTCTGAACAAGCAGTGAAGTTCTATGTTGCAGAGGTCCTTCTTG
 
. : . : . : . : . : . :
JMFF014M09- CTCTAGAATATCTTCACATGCTTGGCATTGTCTACCGTGACCTCAAGCCCGAAAACGTCC
JMFF049N16- CTCTAGAATATCTTCACATGCTTGGCATTGTCTACCGTGACCTCAAGCCCGAAAACGTCC
                      ____________________________________________________________
consensus CTCTAGAATATCTTCACATGCTTGGCATTGTCTACCGTGACCTCAAGCCCGAAAACGTCC
 
. : . : . : . : . : . :
JMFF014M09- TTGTCAGGGACGATGGGCACATTATGCTCTCCGACTTTGACCTCTCCCTTCGCTGTGCTG
JMFF049N16- TTGTCAGGGACGATGGGCACATTATGCTCTCCGACTTTGACCTCTCCCTTCGCTGTGCTG
                      ____________________________________________________________
consensus TTGTCAGGGACGATGGGCACATTATGCTCTCCGACTTTGACCTCTCCCTTCGCTGTGCTG
 
. : . : . : . : . : . :
JMFF014M09- TCAGTCTAACAGTTGTCAAGTCATCGTCTCTCGAGACGGAACCCCTCAGGAAAAATTCTG
JMFF049N16- TCAGTCTAACAGTTGTCAAGTCATCGTCTCTCGAGACGGAACCCCTCAGGAAAAATTCTG
                      ____________________________________________________________
consensus TCAGTCTAACAGTTGTCAAGTCATCGTCTCTCGAGACGGAACCCCTCAGGAAAAATTCTG
 
. : . : . : . : . : . :
JMFF014M09- TTTACTGTGTCCAGCCTGCCTGCATCCAGCCATCCTGTGCGGTCCCCACGACGTG-TTTT
JMFF049N16- TTTACTGTGTCCAGCCTGCCTGCATCCAGCCATCCTGTGCGGTCCCCACGACGTG-TTTT
rJMFF014M09+ TGTGTCCAGCCTGCCTGCATCCAGCCATCCTGTGCGGTCCCCACGACGTGTTTTT
                      ____________________________________________________________
consensus TTTACTGTGTCCAGCCTGCCTGCATCCAGCCATCCTGTGCGGTCCCCACGACGTG-TTTT
 
. : . : . : . : . : . :
JMFF014M09- GGGCCCCGCTTTTTCTCGGGCAAGTCGAAGAAAGAGAGGAAGCCCAAGAACGAAGTTGGT
JMFF049N16- GGGCCCCGCTTTTTCTCGGGCAAGTCGAAGAAAGAGAGGAAGCCCAAGAACGAAGTTGGT
rJMFF014M09+ GGGCCCCGCTTTTTCTCGGGCAAGTCGAAGAAAGAGAGGAAGCCCAAGAACGAAGTTGGT
rJMSF026G03+ AAAGAGAGGAAGCCCAAGAACGAAGTTGGT
                      ____________________________________________________________
consensus GGGCCCCGCTTTTTCTCGGGCAAGTCGAAGAAAGAGAGGAAGCCCAAGAACGAAGTTGGT
 
. : . : . : . : . : . :
JMFF014M09- AACCAAGTCAGCCCCTTACCCGAGCTCATTGCTGAGCCAACCGGAGCTCGTTCCATGTCG
JMFF049N16- AACCAAGTCAGCCCCTTACCCGAGCTCATTGCTGAGCCAACCGGAGCTCGTTCCATGTCG
rJMFF014M09+ AACCAAGTCAGCCCCTTACCCGAGCTCATTGCTGAGCCAACCGGAGCTCGTTCCATGTCG
rJMSF026G03+ AACCAAGTCAGCCCCTTACCCGAGCTCATTGCTGAGCCAACCGGAGCTCGTTCCATGTCG
                      ____________________________________________________________
consensus AACCAAGTCAGCCCCTTACCCGAGCTCATTGCTGAGCCAACCGGAGCTCGTTCCATGTCG
 
. : . : . : . : . : . :
JMFF014M09- TTCG
JMFF049N16- TTCGTGGGGACCC
rJMFF049N16+ TCAAAGGGGAAGGGCACGGCAG
rJMFF014M09+ TTCGTGGGGACCCACGAGTATTCTGGCGCCCGAGATTATCAAAGGGGAAGGGCACGGCAG
rJMSF026G03+ TTCGTGGGGACCCACGAGTA-TCTGGCGCCCGAGATTATCAAAGGGGAAGGGCACGGCAG
                      ____________________________________________________________
consensus TTCGTGGGGACCCACGAGTATTCTGGCGCCCGAGATTATCAAAGGGGAAGGGCACGGCAG
 
. : . : . : . : . : . :
rJMFF049N16+ TGCTGTGGACTGGTGGACTTTCGGGATCTTCCTGTACGAGTTGTTATTTGGTAAGACGCC
rJMFF014M09+ TGCTGTGGACTGGTGGACTTTCGGGATCTTCCTGTACGAGTTGTTATTTGGTAAGACGCC
rJMSF026G03+ TGCTGTGGACTGGTGGACTTTCGGGATCTTCCTGTACGAGTTGTTATTTGGTAAGACGCC
rJMFF043B22+ GACTGGTGGACTTTCGGGATCTTCCTGTACGAGTTGTTATTTGGTAAGACGCC
                      ____________________________________________________________
consensus TGCTGTGGACTGGTGGACTTTCGGGATCTTCCTGTACGAGTTGTTATTTGGTAAGACGCC
 
. : . : . : . : . : . :
rJMFF049N16+ TTTCAAGGGATCAGACAATCGAGCTACCCTTTTCAACGTGGTTGGGCAGCCTCTACGCTT
rJMFF014M09+ TTTCAAGGGATCAGACAATCGAGCTACCCTTTTCAACGTGGTTGGGCAGCCTCTACGCTT
rJMSF026G03+ TTTCAAGGGATCAGACAATCGAGCTACCCTTTTCAACGTGGTTGGGCAGCCTCTACGCTT
rJMFF043B22+ TTTCAAGGGATCAGACAATCGAGCTACCCTTTTCAACGTGGTTGGGCAGCCTCTACGCTT
                      ____________________________________________________________
consensus TTTCAAGGGATCAGACAATCGAGCTACCCTTTTCAACGTGGTTGGGCAGCCTCTACGCTT
 
. : . : . : . : . : . :
rJMFF049N16+ CCCAGAATCCCCGGTTGTCAGCTTTTCTGCTAGAGATCTGATTCGAGGCCTGCTCGTGAA
rJMFF014M09+ CCCAGAATCCCCGGTTGTCAGCTTTTCTGCTAGAGATCTGATTCGAGGCCTGCTCGTGAA
rJMSF026G03+ CCCAGAATCCCCGGTTGTCAGCTTTTCTGCTAGAGATCTGATTCGAGGCCTGCTCGTGAA
rJMFF043B22+ CCCAGAATCCCCGGTTGTCAGCTTTTCTGCTAGAGATCTGATTCGAGGCCTGCTCGTGAA
                      ____________________________________________________________
consensus CCCAGAATCCCCGGTTGTCAGCTTTTCTGCTAGAGATCTGATTCGAGGCCTGCTCGTGAA
 
. : . : . : . : . : . :
rJMFF049N16+ AGAGCCACAGAATCGTCTTGCATATAAACGGGGAGCTACCGAGATTAAGCAGCATCCATT
rJMFF014M09+ AGAGCCACAGAATCGTCTTGCATATAAACGGGGAGCTACCGAGATTAAGCAGCATCCATT
rJMSF026G03+ AGAGCCACAGAATCGTCTTGCATATAAACGGGGAGCTACCGAGATTAAGCAGCATCCATT
rJMFF043B22+ AGAGCCACAGAATCGTCTTGCATATAAACGGGGAGCTACCGAGATTAAGCAGCATCCATT
                      ____________________________________________________________
consensus AGAGCCACAGAATCGTCTTGCATATAAACGGGGAGCTACCGAGATTAAGCAGCATCCATT
 
. : . : . : . : . : . :
rJMFF049N16+ CTTCGAAGGGGTAAACTGGGCATTAATCCGCTGTGCTAGCCCTCCCGAGGT
rJMFF014M09+ CTTCGAAGGGGTAAACTGGGCATTAATCCGCTGTGCTAGCCCTCCCGAGGTCCCCAGGCC
rJMSF026G03+ CTTCGAAGGGGTAAACTGGGCATTAATCCGCTGTGCTAGCCCTCCCGAGGTCCCCAGGCC
rJMFF043B22+ CTTCGAAGGGGTAAACTGGGCATTAATCCGCTGTGCTAGCCCTCCCGAGGTCCCCAGGCC
                      ____________________________________________________________
consensus CTTCGAAGGGGTAAACTGGGCATTAATCCGCTGTGCTAGCCCTCCCGAGGTCCCCAGGCC
 
. : . : . : . : . : . :
rJMFF014M09+ GGTCGACTTTGAGAGGATTCAAGCCCCGCCACCGCCATCAACAACCAAGAAAGCTGCTGG
rJMSF026G03+ GGTCGACTTTGAGAGGATTCAAGCCCCGCCACCGCCATCAACAACCAAGAAAGCTGCTGT
rJMFF043B22+ GGTCGACTTTGAGAGGATTCAAGCCCCGCCACCGCCATCAACAACCAAGAAAGCTGCTGG
                      ____________________________________________________________
consensus GGTCGACTTTGAGAGGATTCAAGCCCCGCCACCGCCATCAACAACCAAGAAAGCTGCTGG
 
. : . : . : . : . : . :
rJMFF014M09+ TGGAGCTCTCCCTTACCATCAAAATCCAGACAACTATCTTGAATTCGATTTCTTCTAAGC
rJMSF026G03+ TGGAGCTCTCCCTTACCATCAAAATCCAGACAACTATCTTGAATTCGATTTCTTCTAAGC
rJMFF043B22+ TGGAGCTCTCCCTTACCATCAAAATCCAGACAACTATCTTGAATTCGATTTCTTCTAAGC
                      ____________________________________________________________
consensus TGGAGCTCTCCCTTACCATCAAAATCCAGACAACTATCTTGAATTCGATTTCTTCTAAGC
 
. : . : . : . : . : . :
rJMFF014M09+ GGATTGACTCACATTTTGGTTTGGCAGTTGGCACAACCAAATGAAATGAACGTACAAGGT
rJMSF026G03+ GGATTGACTCACATTTTGGTTTGGCAGTTGGCACAACCAAATGAAATGAACGTACAAGGT
rJMFF043B22+ GGATTGACTCACATTTTGGTTTGGCAGTTGGCACAACCAAATGAAATGAACGTACAAGGT
                      ____________________________________________________________
consensus GGATTGACTCACATTTTGGTTTGGCAGTTGGCACAACCAAATGAAATGAACGTACAAGGT
 
. : . : . : . : . : . :
rJMFF014M09+ TACAAGTGTA
rJMSF026G03+ TACAAGTGTATGTTTGGAATGTTGGTAGTTAATGATGATACTATCTGTGTTTTGTGAACG
rJMFF043B22+ TACAAGTGTATGTTTGGAATGTTGGTAGTTAATGATGATACTATCTGTGTTTTGTGAACG
                      ____________________________________________________________
consensus TACAAGTGTATGTTTGGAATGTTGGTAGTTAATGATGATACTATCTGTGTTTTGTGAACG
 
. : . : . : . : . : . :
rJMSF026G03+ GTTGGGTTCAATTTTGTTGTACTGCAAAT
rJMFF043B22+ GTTGGGTTCAATTTTGTTGTACTGCAAATATTCTCTAGTGTTTACGCTATTATTGGTCAG
                      ____________________________________________________________
consensus GTTGGGTTCAATTTTGTTGTACTGCAAATATTCTCTAGTGTTTACGCTATTATTGGTCAG