Previous Contig 010276:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF020K04Sequence511001832 (7)769010276 (7)gb:AB020749_15146383e-43Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.
JMFF043B08Sequence631001832 (7)gb:AY045931_15614292e-07Arabidopsis thaliana putative mitogen-activated protein kinase (At1g18150) mRNA,649010276 (7)gb:AB020749_15146387e-11Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.
JMFN019O15Sequence626010276 (7)gb:AB020749_15146382e-19Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.
JMSF004G18Sequence465003545 (6)sp|Q40517|NTF3_TOBAC6e-10Mitogen-activated protein kinase homolog NTF3 (EC 2.7.1.37) (P43).>pir|S39559|S3381010276 (7)
JMSF012L10Sequence521001832 (7)gb:AY045931_15614290.003Arabidopsis thaliana putative mitogen-activated protein kinase (At1g18150) mRNA,755010276 (7)gb:AB020749_15146384e-46Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.
JMSF013O01Sequence360001832 (7)732010276 (7)gb:AB020749_15146384e-46Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.
JMSF045L20Sequence686001832 (7)gb:AY045931_15614295e-39Arabidopsis thaliana putative mitogen-activated protein kinase (At1g18150) mRNA,702010276 (7)gb:AB020749_15146382e-35Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MRC8.

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF012L10+ CGTGA
                      ____________________________________________________________
consensus CGTGA
 
. : . : . : . : . : . :
rJMSF013O01+ TTCTAGAATATCACCCACAGATGCTTCAGGAGTATCTCCAGGGTGGAGATCAGACTAG
rJMSF045L20+ AGATCAGACTAG
rJMSF012L10+ GATTCTAGAATATCACCCACAGATGCTTCAGGAGTATCTCCAGGGTGGAGATCAGACTAG
rJMFF020K04+ TTCTAGAATATCACCCACAGATGCTTCAGGAGTATCTCCAGGGTGGAGATCAGACTAG
                      ____________________________________________________________
consensus GATTCTAGAATATCACCCACAGATGCTTCAGGAGTATCTCCAGGGTGGAGATCAGACTAG
 
. : . : . : . : . : . :
rJMSF013O01+ TGGCTTTATGTACCCAAGTGGTGTTGATCGATTCAAGCGACAATTTGCACATCTTGAGGA
rJMSF045L20+ TGGCTTTATGTACCCAAGTGGTGTTGATCGATTCAAGCGACAATTTGCACATCTTGAGGA
rJMSF012L10+ TGGCTTTATGTACCCAAGTGGTGTTGATCGATTCAAGCGACAATTTGCACATCTTGAGGA
rJMFF020K04+ TGGCTTTATGTACCCAAGTGGTGTTGATCGATTCAAGCGACAATTTGCACATCTTGAGGA
                      ____________________________________________________________
consensus TGGCTTTATGTACCCAAGTGGTGTTGATCGATTCAAGCGACAATTTGCACATCTTGAGGA
 
. : . : . : . : . : . :
rJMSF013O01+ GCATTATGGTAAAGGTGAAAGGAGCACTCCGCTTCAGAGGCAGCACGCCTCTTTGCCTAG
rJMSF045L20+ GCATTATGGTAAAGGTGAAAGGAGCACTCCGCTTCAGAGGCAGCACGCCTCTTTGCCTAG
rJMSF012L10+ GCATTATGGTAAAGGTGAAAGGAGCACTCCGCTTCAGAGGCAGCACGCCTCTTTGCCTAG
JMFN019O15- CACTCCGCTTCAGAGGCAGCACGCCTCTTTGCCTAG
rJMFF020K04+ GCATTATGGTAAAGGTGGAAGGAGCACTCCGCTTCAGAGGCAGCACGCCTCTTTGCCTAG
                      ____________________________________________________________
consensus GCATTATGGTAAAGGTGAAAGGAGCACTCCGCTTCAGAGGCAGCACGCCTCTTTGCCTAG
 
. : . : . : . : . : . :
rJMSF013O01+ AGAGCGGGTGCCTGCACTCAAAGGCTCTCATGAGAGTGATTTTGAAAAGCGAACCTCAAT
rJMSF045L20+ AGAGCGGGTGCCTGCACTCAAAGGCTCTCATGAGAGTGATTTTGAAAAGCGAACCTCAAT
rJMSF012L10+ AGAGCGGGTGCCTGCACTCAAAGGCTCTCATGAGAGTGATTTTGAAAAGCGAACCTCAAT
JMFN019O15- AGAGCGGGTGCCTGCACTCAAAGGCTCTCATGAGAGTGATTTTGAAAAGCGAACCTCAAT
rJMFF020K04+ AGAGCGGGTGCCTGTACTCAAAGGCTCTCATGAGAGTGATTTTGAAAAGCGAACCTCAAT
rJMFF043B08+ GCCTGTACTCAAAGGCTCTCATGAGAGTGATTNTGAAAAGCGAACCTCAAT
                      ____________________________________________________________
consensus AGAGCGGGTGCCTGCACTCAAAGGCTCTCATGAGAGTGATTTTGAAAAGCGAACCTCAAT
 
. : . : . : . : . : . :
rJMSF013O01+ TGCTTCAACTCTTCAGAGTCCACCAGATGGATCAGACAATACACAAAACGGATCAAACTT
rJMSF045L20+ TGCTTCAACTCTTCAGAGTCCACCAGATGGATCAGACAATACACAAAACGGATCAAACTT
rJMSF012L10+ TGCTTCAACTCTTCAGAGTCCACCAGATGGATCAGACAATACACAAAACGGATCAAACTT
JMFN019O15- TGCTTCAACTCTTCAGAGTCCACCAGATGGATCAGACAATACACAAAACGGATCAAACTT
rJMFF020K04+ TGCTTCAACTCTTCAGAGTCCACCAGATGGATCAGACAATACACAAAACGGATCAAACTT
rJMFF043B08+ TGCTTCAACTCTTCAGAGTCCACCAGATGGATCAGACAATACACAAAACGGATCAAACTT
                      ____________________________________________________________
consensus TGCTTCAACTCTTCAGAGTCCACCAGATGGATCAGACAATACACAAAACGGATCAAACTT
 
. : . : . : . : . : . :
rJMSF013O01+ TAGTGCTCGAAGCCTGCTAAAGAGTAATAGTATCAGTGCTTCAAAATGCATAGAAGTTAA
rJMSF045L20+ TAGTGCTCGAAGCCTGCTAAAGAGTAATAGTATCAGTGCTTCAAAATGCATAGAAGTTAA
rJMSF012L10+ TAGTGCTCGAAGCCTGCTAAAGAGTAATAGTATCAGTGCTTCAAAATGCATAGAAGTTAA
JMFN019O15- TAGTGCTCGAAGCCTGCTAAAGAGTAATAGTATCAGTGCTTCAAAATGCATAGAAGTTAA
rJMFF020K04+ TAGTGCTCGAAGCCTGCTAAAGAGTAATAGTATCAGTGCTTCAAAATGCATAGAAGTTAA
rJMFF043B08+ TAGTGCTCGAAGCCTGCTAAAGAGTAATAGTATCAGTGCTTCAAAATGCATAGAAGTTAA
                      ____________________________________________________________
consensus TAGTGCTCGAAGCCTGCTAAAGAGTAATAGTATCAGTGCTTCAAAATGCATAGAAGTTAA
 
. : . : . : . : . : . :
rJMSF013O01+ AAGACGGGATGGAGAGGAAGAT-CCAATTGAAGAGCAAAATGAGGACGTTGATGAGTTAT
rJMSF045L20+ AAGACGGGATGGAGAGGAAGAT-CCAATTGAAGAGCAAAATGAGGACGTTGATGAGTTAT
rJMSF012L10+ AAGACGGGATGGAGAGGAAGAT-CCAATTGAAGAGCAAAATGAGGACGTTGATGAGTTAT
rJMSF004G18+ GAGAGGAAGATNCCAATTGAAGAGCAAAATGAGGACGTTGATGAGTTAT
JMFN019O15- AAGACGGGATGGAGAGGAAGAT-CCAATTGAAGAGCAAAATGAGGACGTTGATGAGTTAT
rJMFF020K04+ AAGACGGGATGGAGAGGAAGAT-CCAATTGAAGAGCAAAATGAGGACGTTGATGAGTTAT
rJMFF043B08+ AAGACGGGATGGAGAGGAAGAT-CCAATTGAAGAGCAAAATGAGGACGTTGATGAGTTAT
                      ____________________________________________________________
consensus AAGACGGGATGGAGAGGAAGAT-CCAATTGAAGAGCAAAATGAGGACGTTGATGAGTTAT
 
. : . : . : . : . : . :
rJMSF013O01+ CTCAGAAAATGTCCAATCTCCATGCCTAATTCCACGGTTCAGCATATTACTCGACGGTTT
rJMSF045L20+ CTCAGAAAATGTCCAATCTCCATGCCTAATTCCACGGTTCAGCATATTACTCGACGGTTT
rJMSF012L10+ CTCAGAAAATGTCCAATCTCCATGCCTAATTCCACGGTTCAGCATATTACTCGACGGTTT
rJMSF004G18+ CTCAGAAAATGTCCAATCTCCATGCCTAATTCCACGGTTCAGCATATTACTCGACGGTTC
JMFN019O15- CTCAGAAAATGTCCAATCTCCATGCCTAATTCCACGGTTCAGCATATTACTCGACGGTTT
rJMFF020K04+ CTCAGAAAATGTCCAATCTCCATGCCTAATTCCACGGTTCAGCATATTACTCGACGGTTT
rJMFF043B08+ CTCAGAAAATGTCCAATCTCCATGCCTAATTCCACGGTTCAGCATATTACTCGACGGTTT
                      ____________________________________________________________
consensus CTCAGAAAATGTCCAATCTCCATGCCTAATTCCACGGTTCAGCATATTACTCGACGGTTT
 
. : . : . : . : . : . :
rJMSF013O01+ GATTACTTTCTGCCATTTTGTGCTGCATCATTTGCGTGGGTCTGCAGCGTTTCATAGTAC
rJMSF045L20+ GATTACTTTCTGCCATTTTGTGCTGCATCATTTGCGTGGGTCTGCAGCGTTTCATAGTAC
rJMSF012L10+ GATTACTTTCTGCCATTTTGTGCTGCATCATTTGCGTGGGTCTGCAGCGTTTCATAGTAC
rJMSF004G18+ GATTACTTTCTGCCATTTTGTGTTGCATCATTTGCGTGGGTCTGCAGCGTTTCATAGTAC
JMFN019O15- GATTACTTTCTGCCATTTTGTGCTGCATCATTTGCGTGGGTCTGCAGCGTTTCATAGTAC
rJMFF020K04+ GATTACTTTCTGCCATTTTGTGCTGCATCATTTGCGTGGGTCTGCAGCGTTTCATAGTAC
rJMFF043B08+ GATTACTTTCTGCCATTTTGTGCTGCATCATTTGCGTGGGTCTGCAGCGTTTCATAGTAC
                      ____________________________________________________________
consensus GATTACTTTCTGCCATTTTGTGCTGCATCATTTGCGTGGGTCTGCAGCGTTTCATAGTAC
 
. : . : . : . : . : . :
rJMSF013O01+ GAAGTTTTGGGTAGAGGCTAACAGTAGTCTGCCAAAGTCGGTATTTGTTGTTTGATTGCA
rJMSF045L20+ GAAGTTTTGGGTAGAGGCTAACAGTAGTCTGCCAAAGTCGGTATTTGTTGTTTGATTGCA
rJMSF012L10+ GAAGTTTTGGGTAGAGGCTAACAGTAGTCTGCCAAAGTCGGTATTTGTTGTTTGATTGCA
rJMSF004G18+ GAAGTTTTGGGTAGAGGCTAACAGTAGTCTGCCAAAGTCGGTATNTGTTGTTTGATTGCA
JMFN019O15- GAAGTTTTGGGTAGAGGCTAACAGTAGTCTGCCAAAGTCGGTATTTGTTGTTTGATTGCA
rJMFF020K04+ GAAGTTTTGGGTAGAGGCTAACAGTAGTCTGCCAAAGTCGGTATTTGTTGTTTGATTGCA
rJMFF043B08+ GAAGTTTTGGGTAGAGGCTAACAGTAGTCTGCCAAAGTCGGTATTTGTTGTTTGATTGCA
                      ____________________________________________________________
consensus GAAGTTTTGGGTAGAGGCTAACAGTAGTCTGCCAAAGTCGGTATTTGTTGTTTGATTGCA
 
. : . : . : . : . : . :
rJMSF013O01+ CTGTTGTCATTCTTTGTTTATAGAGCCAACACTCCCCAGTTATTTGGAGGCTGGCGAGTA
rJMSF045L20+ CTGTTGTCATTCTTTGTTTATAGAGCCAACACTCCCCAGTTATTTGGAGGCTGGCGAGTA
rJMSF012L10+ CTGTTGTCATTCTTTGTTTATAGAGCCAACACTCCCCAGTTATTTGGAGGCTGGCGAGTA
rJMSF004G18+ CTGTTGTCATTCTTTGTTTATAGANCCAACACTCCCCAGTTATTTGGAGGCTGGCGAGCA
JMFN019O15- CTGTTGTCATTCTTTGTTTATAGAGCCAACACTCCCCAGTTATTTGGAGGCTGGCGAGTA
rJMFF020K04+ CTGTTGTCATTCTTTGTTTATAGAGCCAACACTCCCCAGTTATTTGGAGGCTGGCGAGTA
rJMFF043B08+ CTGTTGTCATTCTTTGTTTATAGAGCCAACACTCCCCAGTTATTTGGAGGCTGGCGAGTA
                      ____________________________________________________________
consensus CTGTTGTCATTCTTTGTTTATAGAGCCAACACTCCCCAGTTATTTGGAGGCTGGCGAGTA
 
. : . : . : . : . : . :
rJMSF013O01+ TATGTAGTTTTTCCTTTTGCCCTATATGTTGTATTTACTATTTTATATTGTC
rJMSF045L20+ TATGTAGTTTTTCCTTTTGCCCTATATGTTGTATTTACTATTTTATATTGT-CACCGTTG
rJMSF012L10+ TATGTAGTTTTTCCTTTTGCCCTATATGTTGTATTTACTATTTTATATTGT-CACCGTTG
rJMSF004G18+ TATGTNGTTTTTCCTTNTGCCCTATATGTTGTATTTACTATTTTATATGGTACACCGNAG
JMFN019O15- TATGTAGTTTTTCCTTTTGCCCTATATGTTGTATTTACTATTTTATATTGT-CACCGTTG
rJMFF020K04+ TATGTAGTTTTTCCTTTTGCCCTATATGTTGTATTTACTATTTTATGTTGT-CACCGTTG
rJMFF043B08+ TATGTAGTTTTTCCTTTTGCCCTATATGTTGTATTTACTATTTTATGTTGT-CACCGTTG
                      ____________________________________________________________
consensus TATGTAGTTTTTCCTTTTGCCCTATATGTTGTATTTACTATTTTATATTGT-CACCGTTG
 
. : . : . : . : . : . :
rJMSF045L20+ ATTATAATTTATCTGTAACGACTCGATATTAC
rJMSF012L10+ ATTATAATTTATCTGTAACGACTCGATATTAC
rJMSF004G18+ ATTNTAATTTATCTGTAACGAC
JMFN019O15- ATTATAATTTATCTGTAACGACTCGATATTACTGGACAGATTGAGTAAAACA
rJMFF020K04+ ATTATAATTTATCTGTAACGACTCGATATTACTGGACAGATTGAGTAAAACA
rJMFF043B08+ ATTATAATTTATCTGTAACGACTCGATATTACTGGACAGATTGAGTAAAACATTGTGCCA
                      ____________________________________________________________
consensus ATTATAATTTATCTGTAACGACTCGATATTACTGGACAGATTGAGTAAAACATTGTGCCA
 
. : . : . : . : . : . :
rJMFF043B08+ TTATGTGGTTTTGCTTGACAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG
                      ____________________________________________________________
consensus TTATGTGGTTTTGCTTGACAAAAAAAAAAAAAAAACTCTCCAGGGTGATCCGCCATAAGG