Previous Contig 010273:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002J19Sequence451010273 (4)gb:AC135228_17421938e-04Oryza sativa chromosome 3 BAC OSJNBb0122C16 genomic sequence, complete sequence.742010273 (4)gb:AF083765_17669954e-05Arabidopsis thaliana clone sps687 unknown mRNA.
JMFF043A13Sequence615010273 (4)gb:AF083765_17669953e-05Arabidopsis thaliana clone sps687 unknown mRNA.635010273 (4)gb:AK176450_18184380.002Arabidopsis thaliana mRNA, complete cds, clone: RAFL24-22-E06.

Alignment

This contig is upended


. : . : . : . : . : . :
JMFF002J19- ACTTATCTTTTTTGTCCACTGCTATTACTGGTAAGTATTTTGTCCCCT
                      ____________________________________________________________
consensus ACTTATCTTTTTTGTCCACTGCTATTACTGGTAAGTATTTTGTCCCCT
 
. : . : . : . : . : . :
JMFF002J19- TCCCTTTGTTTCCAAGCATGATGTTCTTTGCTCCTTCTGGGGCGTTAAAGATTCTTCAAA
                      ____________________________________________________________
consensus TCCCTTTGTTTCCAAGCATGATGTTCTTTGCTCCTTCTGGGGCGTTAAAGATTCTTCAAA
 
. : . : . : . : . : . :
JMFF002J19- GAAAATTTAATGTTTGGTATTCCTAGTTTTAGTTATATGTATGAATCTGGTGTCTGATAT
                      ____________________________________________________________
consensus GAAAATTTAATGTTTGGTATTCCTAGTTTTAGTTATATGTATGAATCTGGTGTCTGATAT
 
. : . : . : . : . : . :
JMFF002J19- AATTCTTGAACATTAAACAGGCTGTTTCAGTTTCATCTCTGCTTTCCTGGTAAATGGATT
JMFF043A13- GGCTGTTTCAGTTTCATCTCTGCTTTCCTGGTAAATGGATT
rJMFF002J19+ GGCTGTTTCAGTTTCATCTCTGCTTTCCTGGTAAATGGATT
                      ____________________________________________________________
consensus AATTCTTGAACATTAAACAGGCTGTTTCAGTTTCATCTCTGCTTTCCTGGTAAATGGATT
 
. : . : . : . : . : . :
JMFF002J19- GCTGAATTTTTGGGGGTGAGAGAGAGAGAGAGAGAGAGAGATTGAAGATGTTGTTGAAGC
JMFF043A13- GCTGAATTTTTGGGGGTGAGAGAGAGAGAGAGAGAGAGAGATTGAAGATGTTGTTGAAGC
rJMFF002J19+ GCTGAATTTTTGGGGGTGAGAGAGAGAGAGAGAGAGAGAGATTGAAGATGTTGTTGAAGC
                      ____________________________________________________________
consensus GCTGAATTTTTGGGGGTGAGAGAGAGAGAGAGAGAGAGAGATTGAAGATGTTGTTGAAGC
 
. : . : . : . : . : . :
JMFF002J19- AATCATCAAGTANGAATTTGAGGGCGAAAGGGTTCAAGTTGAAGCATGGATTTCAGATAT
JMFF043A13- AATCATCAAGTAGGAATTTGAGGGCGAAAGGGTTCAAGTTGAAGCATGGATTTCAGATAT
rJMFF002J19+ AATCATCAAGTAGGAATTTGAGGGCGAAAGGGTTCAAGTTGAAGCATGGATTTCAGATAT
rJMFF043A13+ GAAAGGGTTCAAGTGNAATCATGGATTTCAGATAT
                      ____________________________________________________________
consensus AATCATCAAGTAGGAATTTGAGGGCGAAAGGGTTCAAGTTGAAGCATGGATTTCAGATAT
 
. : . : . : . : . : . :
JMFF002J19- GTGTGGTTCTTGCCCTCTGCATATGGCTGCTTTATCAGGTGAACAAATCTTACAGCAAGA
JMFF043A13- GTGTGGTTCTTGCCCTCTGCATATGGCTGCTTTATCAGGTGAACAAATCTTACAGCAAGA
rJMFF002J19+ GTGTGGTTCTTGCCCTCTGCATATGGCTGCTTTATCAGGTGAACAAATCTTACAGCAAGA
rJMFF043A13+ GTGTGGTTCTTGCCCTCTGCATATGGCTGCTTTATCAGGTGAACAAATCTTACAGCAAGA
                      ____________________________________________________________
consensus GTGTGGTTCTTGCCCTCTGCATATGGCTGCTTTATCAGGTGAACAAATCTTACAGCAAGA
 
. : . : . : . : . : . :
JMFF002J19- AGGGTGGAATTGAGGGAGGTGGCAGTGAGGTATCTGGGCAGGG
JMFF043A13- AGGGTGGAATTGAGGGAGGTGGCAGTGAGGTATCTGGGCAGGGAGGAGGAGAAAGCAGCA
rJMFF002J19+ AGGGTGGAATTGAGGGAGGTGGCAGTGAGGTATCTGGGCAGGGAGGAGGAGAAAGCAGCA
rJMFF043A13+ AGGGTGGAATTGAGGGAGGTGGCAGTGAGGTATCTGGGCAGGGAGGAGGAGAAAGCAGCA
                      ____________________________________________________________
consensus AGGGTGGAATTGAGGGAGGTGGCAGTGAGGTATCTGGGCAGGGAGGAGGAGAAAGCAGCA
 
. : . : . : . : . : . :
JMFF043A13- GGCTTCAGATTCTCAAGTTAGGGAGGAAGGGCCTGAACCCGGAGATTGAGGACGAGGAGG
rJMFF002J19+ GGCTTCAGATTCTCAAGTTAGGGAGGAAGGGCCTGAACCCGGAGATTGAGGACGAGGAGG
rJMFF043A13+ GGCTTCAGATTCTCAAGTTAGGGAGGAAGGGCCTGAACCCGGAGATTGAGGACGAGGAGG
                      ____________________________________________________________
consensus GGCTTCAGATTCTCAAGTTAGGGAGGAAGGGCCTGAACCCGGAGATTGAGGACGAGGAGG
 
. : . : . : . : . : . :
JMFF043A13- AGGACGCCGGCCTGAAACTCGCCGGAGATGATGAGCCGGAGTTGGATGATGAAGAGAAGA
rJMFF002J19+ AGGACGCCGGCCTGAAACTCGCCGGAGATGATGAGCCGGAGTTGGATGATGAAGAGAAGA
rJMFF043A13+ AGGACGCCGGCCTGAAACTCGCCGGAGATGATGAGCCGGAGTTGGATGATGAAGAGAAGA
                      ____________________________________________________________
consensus AGGACGCCGGCCTGAAACTCGCCGGAGATGATGAGCCGGAGTTGGATGATGAAGAGAAGA
 
. : . : . : . : . : . :
JMFF043A13- AGGTCCGGGCGGAGTTGGAGGATGAAGAGAGGAAGCTGAGGGAGAATGAAGGAGATGATG
rJMFF002J19+ AGGTCCGGGCGGAGTTGGAGGATGAAGAGAGGAAGCTGAGGGAGAATGAAGGAGATGATG
rJMFF043A13+ AGGTCCGGGCGGAGTTGGAGGATGAAGAGAGGAAGCTGAGGGAGAATGAAGGAGATGATG
                      ____________________________________________________________
consensus AGGTCCGGGCGGAGTTGGAGGATGAAGAGAGGAAGCTGAGGGAGAATGAAGGAGATGATG
 
. : . : . : . : . : . :
JMFF043A13- ACACAGATGGAGGTGAGCTAGACAAGGCAGAAGAGCAATTGGAGGATTTGATAGGGGAAG
rJMFF002J19+ ACACAGATGGAGGTGAGCTAGACAAGGCAGAAGAGCAATTGGAGGATTTGATAGGGGAAG
rJMFF043A13+ ACACAGATGGAGGTGAGCTAGACAAGGCAGAAGAGCAATTGGAGGATTTGATAGGGGAAG
                      ____________________________________________________________
consensus ACACAGATGGAGGTGAGCTAGACAAGGCAGAAGAGCAATTGGAGGATTTGATAGGGGAAG
 
. : . : . : . : . : . :
JMFF043A13- AGGATAAAGAAGAATAGGAAAATTTTAGTTTTTAGCCCACTCGGGTAGCTCAGTTTGTTC
rJMFF002J19+ AGGATAAAGAAGAATAGGAAAATTTTAGTTTTTAGCCCACTCGGGTAGCTCAGTTTGTTC
rJMFF043A13+ AGGATAAAGAAGAATAGGAAAATTTTAGTTTTTAGCCCACTCGGGTAGCTCAGTTTGTTC
                      ____________________________________________________________
consensus AGGATAAAGAAGAATAGGAAAATTTTAGTTTTTAGCCCACTCGGGTAGCTCAGTTTGTTC
 
. : . : . : . : . : . :
JMFF043A13- TCGAG
rJMFF002J19+ TCGAGTGATAAATTGTGGGCAAGAATAGGAAATTTTAAGTTTAGGAGGAGGAAAACCAAG
rJMFF043A13+ TCGAGTGATAAATTGTGGGCAAGAATAGGAAATTTTAAGTTTAGGAGGAGGAAAACCAAG
                      ____________________________________________________________
consensus TCGAGTGATAAATTGTGGGCAAGAATAGGAAATTTTAAGTTTAGGAGGAGGAAAACCAAG
 
. : . : . : . : . : . :
rJMFF002J19+ TGTATTATTCAATCTGTAATCTCTGATTACATAGGATTTAGCAAACTGCATTCTATGTAA
rJMFF043A13+ TGTATTATTCAATCTGTAATCTCTGATTACATAGGATTTAGCAAACTGCATTCTATGTAA
                      ____________________________________________________________
consensus TGTATTATTCAATCTGTAATCTCTGATTACATAGGATTTAGCAAACTGCATTCTATGTAA
 
. : . : . : . : . : . :
rJMFF002J19+ TCATCACTCTGCACT
rJMFF043A13+ TCATCACTCTGCACTATAAAAATGTTCTTTTGAGACAGAAAAAAAAAAAAAACTCTCCAG
                      ____________________________________________________________
consensus TCATCACTCTGCACTATAAAAATGTTCTTTTGAGACAGAAAAAAAAAAAAAACTCTCCAG