Previous Contig 010265:  Sequence
BLAST Hits against nr-aa DB Show

clone5'-sequence3'-sequence
Seq.lengthcontigBestHitEvaluedescriptionlengthcontigBestHitEvaluedescription
JMFF002K11Sequence837014085gb:AF528678_18087031e-83Arabidopsis lyrata putative polyubiquitin gene, partial cds.855010265 (10)gb:ATHUBQ10R_15534618e-81Arabidopsis thaliana polyubiquitin (ubq10) mRNA, complete cds.>gb:AY139999_15824
JMFF011I06Sequence790000606 (12)gb:AJ844617_1814726e-123Plantago major mRNA for polyubiquitin (ubq3 gene).920010265 (10)gb:AMUBIQMRP_1819337e-108A.majus mRNA for ubiquitin (partial).
JMFF020M18Sequence772000606 (12)gb:ZMU29159_1732118e-110Zea mays clone MubG1 ubiquitin gene, complete cds.910010265 (10)gb:ATU84969_1557346e-103Arabidopsis thaliana ubiquitin (UBQ11) gene, complete cds.
JMFF024A09Sequence765000606 (12)gb:AMUBIQMRP_18193374e-96A.majus mRNA for ubiquitin (partial).679010265 (10)gb:ATHUBQ10R_15534617e-59Arabidopsis thaliana polyubiquitin (ubq10) mRNA, complete cds.>gb:AY139999_15824
JMFF035M14Sequence776000606 (12)gb:AK056939_19118671e-99Homo sapiens cDNA FLJ32377 fis, clone SKMUS1000014, highly similar to Polyubiqui851010265 (10)gb:AY117055_15791321e-99Gossypium herbaceum putative polyubiquitin gene, partial cds.>gb:AY117056_157913
JMFF042O14Sequence652000606 (12)gb:AMUBIQMRP_1819337e-100A.majus mRNA for ubiquitin (partial).579010265 (10)gb:AMUBIQMRP_18193373e-50A.majus mRNA for ubiquitin (partial).
JMFF045C12Sequence614000606 (12)gb:AMUBIQMRP_18193379e-92A.majus mRNA for ubiquitin (partial).604010265 (10)gb:AMUBIQMRP_18193373e-71A.majus mRNA for ubiquitin (partial).
JMFF051B10Sequence571000606 (12)gb:AMUBIQMRP_18193375e-84A.majus mRNA for ubiquitin (partial).513010265 (10)gb:AMUBIQMRP_18193372e-45A.majus mRNA for ubiquitin (partial).
JMFN037B12Sequence589010265 (10)gb:AMUBIQMRP_1819337e-102A.majus mRNA for ubiquitin (partial).
JMSF040E04Sequence619000606 (12)gb:AMUBIQMRP_18193374e-84A.majus mRNA for ubiquitin (partial).1047010265 (10)gb:AMUBIQMRP_1819337e-135A.majus mRNA for ubiquitin (partial).

Alignment

This contig is upended


. : . : . : . : . : . :
rJMSF040E04+ AAAANTNTTANTGGGCAAGANCCCNTCANTCTGAAGGTGGNGAGNTTCGGATTACCNTTG
                      ____________________________________________________________
consensus AAAANTNTTANTGGGCAAGANCCCNTCANTCTGAAGGTGGNGAGNTTCGGATTACCNTTG
 
. : . : . : . : . : . :
rJMSF040E04+ NCCANTGNGAAGGNNTAAGNATNCAAGATAAGGNAAGGGGATTTCCCCCAGATCAACAGA
                      ____________________________________________________________
consensus NCCANTGNGAAGGNNTAAGNATNCAAGATAAGGNAAGGGGATTTCCCCCAGATCAACAGA
 
. : . : . : . : . : . :
rJMSF040E04+ GGNTGATTTTTNCCCGGAAAGCAGCTTGAAGATGGCCCGTANTCTTGCAGANTACAACAT
                      ____________________________________________________________
consensus GGNTGATTTTTNCCCGGAAAGCAGCTTGAAGATGGCCCGTANTCTTGCAGANTACAACAT
 
. : . : . : . : . : . :
rJMSF040E04+ CCAAAAAGAGTCCACCCTCCATNTTGTCCTCCGCCTGCGTGGTGGCATGCAGATNTTTGT
rJMFF020M18+ ATGCAGATNTTTGT
                      ____________________________________________________________
consensus CCAAAAAGAGTCCACCCTCCATNTTGTCCTCCGCCTGCGTGGTGGCATGCAGATNTTTGT
 
. : . : . : . : . : . :
JMFN037B12- CTTACTGGGAAGACCATCACCC-TGGAGGTTGAAAGTTCAGATACCATTGACA
rJMSF040E04+ CAAAACACTTACTGGGAAGACCATCACCC-TGGAGGTTGAAAGTTCAGATACCATTGACA
rJMFF020M18+ CAAAACNCTTACTGGNAAGACCATCNCCCNTGGAGGTTGAAAGTTCAGATACCATTGACA
rJMFF035M14+ CCCTGGAGGTTGAAAGTTCAGATCCCATTGACA
                      ____________________________________________________________
consensus CAAAACACTTACTGGGAAGACCATCACCCCTGGAGGTTGAAAGTTCAGATACCATTGACA
 
. : . : . : . : . : . :
JMFN037B12- ATGTGAAGG-CAAAGATCCAA-GACAAGGAA-GGCATTCC-TCCAGATCAAC-AAAGGCT
rJMSF040E04+ ATGTGAAGG-CAAAGATCCAA-GACAAGGAA-GGCATTCC-TCCAGATCAAC-AAAGGCT
rJMFF020M18+ ATGTGAAGGNCAAAGATCCAA-GACAAGGAAGGNCATTCCTTCCAGATCANCAAAAGGCT
rJMFF035M14+ ATGTGAAGG-CAAAGATCCAAGGCCAAGGAAGGGCATTCC-TCCAGATCAAC-AAAGGCT
rJMFF011I06+ TCCAA-GATANGGAA-GGGATTCC-CCCAGATCAAC-AGAGGCT
rJMFF002K11+ CAAGGAA-GGCATTCN-TCCAGATCAACAAAAGGCT
                      ____________________________________________________________
consensus ATGTGAAGG-CAAAGATCCAA-GACAAGGAA-GGCATTCC-TCCAGATCAAC-AAAGGCT
 
. : . : . : . : . : . :
JMFN037B12- GATTTTTGCTGGAAAGCAGCTTGAA-GATGG-TCGTACACTTG-CTGATTACAACATCCA
rJMSF040E04+ GATTTTTGCTGGAAAGCAGCTTGAA-GATGG-TCGTACACTTG-CTGATTACAACATCCA
rJMFF020M18+ GATTTTTGCTGGAAAGCAGCTTGAA-GATGG-TCGTACACTTG-CTGATTACAACATCCA
rJMFF035M14+ GATTTTTGCTGGAAAGCAGCTTGAA-GATGG-TCGTACACTTG-CTGATTACAACATCCA
rJMFF011I06+ GATTTTTGCCGGAAAGCAGCTTGAA-GATGG-CCGTACTCTTG-CAGACTACAACATCCA
rJMFF002K11+ GATTTTTGCTGGAAAGCATNTTGAANGATGGTTCGTACNCTTGNNGGATTACAACATCCA
                      ____________________________________________________________
consensus GATTTTTGCTGGAAAGCAGCTTGAA-GATGG-TCGTACACTTG-CTGATTACAACATCCA
 
. : . : . : . : . : . :
JMFN037B12- AAAAGAGT-CCACCCTACATCTTGTCCTCCGCCTTCGTGGTGGCATGCAGATCTTTGTCA
rJMSF040E04+ AAAAGAGT-CCACCCTACATCTTGTCCTCCGCCTTCGTGGTGGCATGCAGATCTTTGTCA
rJMFF020M18+ AAAAGAGT-CCACCCTACATCTTGTCCTCCGCCTTCGTGGTGGCATGCAGATCTTTGTCA
rJMFF035M14+ AAAAGAGTCCACCCNTACATCTTGTCCTCCGCCTTCGTGGTGGCATGCAGATCTTTGTCA
rJMFF011I06+ AAAAGAGT-CCACCCTACATCTTGTCCTCCGCCTTCGTGGTGGCATGCAGATCTTTGTCA
rJMFF002K11+ AAAAGAGTCCCNCCNTACATNTTGTCCTCCGCCTTCGTGGTGGCATGCAGATNTTTGTCA
rJMFF024A09+ GGCATGCAGATTTTTGTCA
                      ____________________________________________________________
consensus AAAAGAGT-CCACCCTACATCTTGTCCTCCGCCTTCGTGGTGGCATGCAGATCTTTGTCA
 
. : . : . : . : . : . :
JMFN037B12- AAACACTAA-CTGGGAAGACCATCACACTGGAGGTTGAGAGTTCAGATACCATTGACAAT
rJMSF040E04+ AAACACTAA-CTGGGAAGACCATCACACTGGAGGTTGAGAGTTCAGATACCATTGACAAT
rJMFF020M18+ AAACACTAA-CTGGGAAGACCATCACACTGGAGGTTGAGAGTTCAGATACCATTGACAAT
rJMFF035M14+ AAACACTAA-CTGGGAAGACCATCACACTGGAGGTTGAGAGTTCAGATACCATTGACAAT
rJMFF011I06+ AAACACTAA-CTGGGAAGACCATCACACTGGAGGTTGAGAGTTCAGATACCATTGACAAT
rJMFF045C12+ AGGTTGAGAGTTCAGATACCATTGACAAT
rJMFF002K11+ AAACNCTAA-CTGGGAAGACCATCACACTGGAGGTTGAGAGTTCAGATACCATTGACAAT
rJMFF024A09+ AAACNCTAACCNGGGAAGNCCATCCCCCTGGAGGTTGAGNGTTCAGATACCATTGGCAAT
                      ____________________________________________________________
consensus AAACACTAA-CTGGGAAGACCATCACACTGGAGGTTGAGAGTTCAGATACCATTGACAAT
 
. : . : . : . : . : . :
JMFN037B12- GTGAAGGCAAAGATTCAGGACAAGGAAGGCATTCCTCCAGACCAACAGCGTTTGATCTTT
rJMSF040E04+ GTGAAGGCAAAGATTCAGGACAAGGAAGGCATTCCTCCAGACCAACAGCGTTTGATCTTT
rJMFF020M18+ GTGAAGGCAAAGATTCAGGACAAGGAAGGCATTCCTCCAGACCAACAGCGTTTGATCTTT
rJMFF035M14+ GTGAAGGCAAAGATTCAGGACAAGGAAGGCATTCCTCCAGACCAACAGCGTTTGATCTTT
rJMFF011I06+ GTGAAGGCAAAGATTCAGGACAAGGAAGGCATTCCTCCAGACCAACAGCGTTTGATCTTT
rJMFF045C12+ GTGAAGGCAAAGATTCAGGACAAGGAAGGCATTCCTCCAGACCAACAGCGTTTGATCTTT
rJMFF002K11+ GTGAAGGCAAAGATTCAGGACAAGGAAGGCATTCCTCCAGACCAACAGCGTTTGATCTTT
rJMFF024A09+ GTGAAGGCAAAGATTCAGGNCAAGGAAGGCATTCCTCCAGACCAACAGCGTTTGATTTTT
                      ____________________________________________________________
consensus GTGAAGGCAAAGATTCAGGACAAGGAAGGCATTCCTCCAGACCAACAGCGTTTGATCTTT
 
. : . : . : . : . : . :
JMFN037B12- GCAGGTAAACAGCTTGAGGATGGGAGGACACTTGCAGACTACAACATTCAGAAGGCCTCT
rJMSF040E04+ GCAGGTAAACAGCTTGAGGATGGGAGGACACTTGCAGACTACAACATTCAGAAGGAGTCT
rJMFF020M18+ GCAGGTAAACAGCTTGAGGATGGGAGGACACTTGCAGACTACAACATTCAGAAGGAGTCT
rJMFF035M14+ GCAGGTAAACAGCTTGAGGATGGGAGGACACTTGCAGACTACAACATTCAGAAGGAGTCT
rJMFF011I06+ GCAGGTAAACAGCTTGAGGATGGGAGGACACTTGCAGACTACAACATTCAGAAGGAGTCT
rJMFF045C12+ GCAGGTAAACAGCTTGAGGATGGGAGGACACTTGCAGACTACAACATTCAGAAGGAGTCT
rJMFF002K11+ GCAGGTAAACAGCTTGAGGATGGGAGGACACTTGCAGACTACAACATTCAGAAGGAGTTT
rJMFF024A09+ GCAGGTAAACAGCTTGAGGATGGGAGGACNCTTGCAGAATACAACATTCAGAAGGAGTTT
rJMFF051B10+ CATTCAGAAGGAGTCT
rJMFF042O14+ GGGAGGACACTTGCAGACTACAACATTCAGAAGGAGTCT
                      ____________________________________________________________
consensus GCAGGTAAACAGCTTGAGGATGGGAGGACACTTGCAGACTACAACATTCAGAAGGAGTCT
 
. : . : . : . : . : . :
JMFN037B12- ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATCTTTGTCAAGACCCTTACA
rJMSF040E04+ ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATCTTTGTCAAGACCCTTACA
rJMFF020M18+ ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATCTTTGTCAAGACCCTTACA
rJMFF035M14+ ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATCTTTGTCAAGACCCTTACA
rJMFF011I06+ ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATCTTTGTCAAGACCCTTACA
rJMFF045C12+ ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATCTTTGTCAAGACCCTTACA
rJMFF002K11+ ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATNTTTGTCAAGACCCTTACA
rJMFF024A09+ NCGCTCCATTTGGTGCTGCGATTGAGGGGCGGTANGCAGATTTTTGTCAAGACCCTTACA
rJMFF051B10+ ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATCTTTGTCAAGACCCTTACA
rJMFF042O14+ ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATCTTTGTCAAGACCCTTACA
                      ____________________________________________________________
consensus ACGCTCCATTTGGTGCTGCGATTGAGGGGCGGTATGCAGATCTTTGTCAAGACCCTTACA
 
. : . : . : . : . : . :
JMFN037B12- GGGAAGACCATCACTCTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGCTAAG
rJMSF040E04+ GGGAAGACCATCACTCTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGCTAAG
rJMFF020M18+ GGGAAGACCATCACTCTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGCTAAG
rJMFF035M14+ GGGAAGACCATCACTCTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGCTAAG
rJMFF011I06+ GGGAAGACCATCACTCTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGCTAAG
rJMFF045C12+ GGGAAGACCATCACTCTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGCTAAG
rJMFF002K11+ GGGAAGACCATCACTNTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGNTAAG
rJMFF024A09+ GGGAAGACCATCNCTTTGGAGGTGGAGAGTTCAGATNCTATTGATAATGTGAAGGNTAAG
rJMFF051B10+ GGGAAGACCATCACTCTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGCTAAG
rJMFF042O14+ GGGAAGACCATCACTCTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGCTAAG
                      ____________________________________________________________
consensus GGGAAGACCATCACTCTGGAGGTGGAGAGTTCAGATACTATTGATAATGTGAAGGCTAAG
 
. : . : . : . : . : . :
JMFN037B12- ATTCAGGACAAGGAAGGGATTCCACCAGATCAGCAGAGGCTGATATTTGCTGGCA
rJMSF040E04+ ATTCAGGACAAGGAAGGGATTCCACCAGATCAGCAGAGGCTGATATTTGCTGGCAAGCAG
rJMFF020M18+ ATTCAGGACAAGGAAGGGATTCCACCAGATCAGCAGAGGCTGATATTTGCTGGCAAGCAG
rJMFF035M14+ ATTCAGGACAAGGAAGGGATTCCACCAGATCAGCAGAGGCTGATATTTGCTGGCAAGCAG
rJMFF011I06+ ATTCAGGACAAGGAAGGGATTCCACCAGATCAGCAGAGGCTGATATTTGCTGGCAAGCAG
rJMFF045C12+ ATTCAGGACAAGGAAGGGATTCCACCAGATCAGCAGAGGCTGATATTTGCTGGCAAGCAG
rJMFF002K11+ ATTCAGGACAAGGAAGGGATTCCNCCAGATCAGCAGAGGCTGATATTTGCTGGCAAGCAG
rJMFF024A09+ ATTCAGGACAAGGAAGGGATTCCNCCAGATCAGCAGAGGNTGATATTTGCTGGCAAGCAG
rJMFF051B10+ ATTCAGGACAAGGAAGGGATTCCACCAGATCAGCAGAGGCTGATATTTGCTGGCAAGCAG
rJMFF042O14+ ATTCAGGACAAGGAAGGGATTCCACCAGATCAGCAGAGGCTGATATTTGCTGGCAAGCAG
                      ____________________________________________________________
consensus ATTCAGGACAAGGAAGGGATTCCACCAGATCAGCAGAGGCTGATATTTGCTGGCAAGCAG
 
. : . : . : . : . : . :
rJMSF040E04+ CTCGAGGATGGGCGCACACTTGCAGACTACAATATCCAGAAGGAGTCCACCCTTCATCTT
rJMFF020M18+ CTCGAGGATGGGCGCACACTTGCAGACTACAATATCCAGAAGGAGTCCACCCTTCATCTT
rJMFF035M14+ CTCGAGGATGGGCGCACACTTGCAGACTACAATATCCAGAAGGAGTCCACCCTTCATCTT
rJMFF011I06+ CTCGAGGATGGGCGCACACTTGCAGACTACAATATCCAGAAGGAGTCCACCCTTCATCTT
rJMFF045C12+ CTCGAGGATGGGCGCACACTTGCAGACTACAATATCCAGAAGGAGTCCACCCTTCATCTT
rJMFF002K11+ CTCGAGGATGGGCGCACACTTGCAGACTACAATATCCAGAAGGAGTCCNCCCTTCATNTT
rJMFF024A09+ CTNGAGGATGGGNGCNCNCTTGCAGNCTNCAATATCCAGAAGGAGTCCNCCCTTCATTTT
rJMFF051B10+ CTCGAGGATGGGCGCACACTTGCAGACTACAATATCCAGAAGGAGTCCACCCTTCATCTT
rJMFF042O14+ CTCGAGGATGGGCGCACACTTGCAGACTACAATATCCAGAAGGAGTCCACCCTTCATCTT
                      ____________________________________________________________
consensus CTCGAGGATGGGCGCACACTTGCAGACTACAATATCCAGAAGGAGTCCACCCTTCATCTT
 
. : . : . : . : . : . :
rJMSF040E04+ GTTCTTCGACTTCGTGGTGGCTTTTAAATATCAAGTCTTATAATCTCTTTGCTATACTTT
rJMFF020M18+ GTTCTTCGACTTCGTGGTGGCTTTTAAATATCAAGTCTTATAATCTCTTTGCTATACTTC
rJMFF035M14+ GTTCTTCGACTTCGTGGTGGCTTTTAAATATCAAGTCTTATAATCTCTTTGCTATACTTC
rJMFF011I06+ GTTCTTCGACTTCGTGGTGGCTTTTAAATATCAAGTCTTATAATCTCTTTGCTATACTTC
rJMFF045C12+ GTTCTTCGACTTCGTGGTGGCTTTTAAATATCAAGTCTTATAATCTCTTTGCTATACTTC
rJMFF002K11+ GTTNTTCGACTTCGTGGTGGCTTTTAAATATCAAGTNTTATAATCTCTTTGCTATACTTC
rJMFF024A09+ GTTTTTNGACTTCGTGGNGGCTTTTAAATATCAAGTTTTATAATNTNTTTGNTATACTTN
rJMFF051B10+ GTTCTTCGACTTCGTGGTGGCTTTTAAATATCAAGTCTTATAATCTCTTTGCTATACTTC
rJMFF042O14+ GTTCTTCGACTTCGTGGTGGCTTTTAAATATCAAGTCTTATAATCTCTTTGCTATACTTC
                      ____________________________________________________________
consensus GTTCTTCGACTTCGTGGTGGCTTTTAAATATCAAGTCTTATAATCTCTTTGCTATACTTC
 
. : . : . : . : . : . :
rJMSF040E04+ TGTCCTTATTTCAAGACAATCCTTGCAACTGCTATAATATAATTGGCAGTACTTATGTTT
rJMFF020M18+ TGTCCTTATTTCAAGACAATCCTTGCAACTGCTATAATATAATTGGCAGTACTTATGTTT
rJMFF035M14+ TGTCCTTATTTCAAGACAATCCTTGCAACTGCTATAATATAATTGGCAGTACTTATGTTT
rJMFF011I06+ TGTCCTTATTTCAAGACAATCCTTGCAACTGCTATAATATAATTGGCAGTACTTATGTTT
rJMFF045C12+ TGTCCTTATTTCAAGACAATCCTTGCAACTGCTATAATATAATTGGCAGTACTTATGTTT
rJMFF002K11+ TGTCCTTATTTCAAGACAATCCTTGCAGCTGCTATAATATAATTGGCAGTACTTATGTTT
rJMFF024A09+ TGTCCTTATTTCAAGACAATCCTTGCAACTGNTATAATATAATTGGCAGTACTTANGTTT
rJMFF051B10+ TGTCCTTATTTCAAGACAATCCTTGCAACTGCTATAATATAATTGGCAGTACTTATGTTT
rJMFF042O14+ TGTCCTTATTTCAAGACAATCCTTGCAACTGCTATAATATAATTGGCAGTACTTATGTTT
                      ____________________________________________________________
consensus TGTCCTTATTTCAAGACAATCCTTGCAACTGCTATAATATAATTGGCAGTACTTATGTTT
 
. : . : . : . : . : . :
rJMSF040E04+ CTGTTCTAGAATAATCTTGTTACCAAAGTGGTTTCCTT
rJMFF020M18+ CTGTTCTAGAATAATCTTGTTACCAAAGTGGTTTCCTTCTGGGCATTTAATGCTTGTTG
rJMFF035M14+ CTGTTCTAGAATAATCTTGTTACCAAAGTGGTTTCCTTCTGGGCATTTAATGCTTGTTGG
rJMFF011I06+ CTGTTCTAGAATAATCTTGTTACCAAAGTGGTTTCCTTCTGGGCATTTAATGCTTGTTGG
rJMFF045C12+ CTGTTCTAGAATAATCTTGTTACCAAAGTGGTTTCCTTCTGGGCATTTAATGCTTGTTGG
rJMFF002K11+ CTGTTNTAGAATAATCTTGTTACCAAAGTGGTTTCCTTCTGGGCATTTAATGCTTGTTGG
rJMFF024A09+ NTGTTTTAGAATAATNTTGTTACCAAAGNGGTTTCCTTTTGGGCATTTAANGCTTGTTGG
rJMFF051B10+ CTGTTCTAGAATAATCTTGTTACCAAAGTGGTTTCCTTCTGGGCATTTAATGCTTGTTGG
rJMFF042O14+ CTGTTCTAGAATAATCTTGTTACCAAAGTGGTTTCCTTCTGGGCATTTAATGCTTGTTGG
                      ____________________________________________________________
consensus CTGTTCTAGAATAATCTTGTTACCAAAGTGGTTTCCTTCTGGGCATTTAATGCTTGTTGG
 
. : . : . : . : . : . :
rJMFF035M14+ TTTCCTTT
rJMFF011I06+ TTTCCTTTTCAATTAATGCATG
rJMFF045C12+ TTTCCTTTTCAATTAATGCATGTTGGTTCTCTGCC
rJMFF002K11+ TTTCCTTTTCAATTAATGCATGTTGGTTCTCTGCC
rJMFF024A09+ TTTCCTTTTCAANTAANGCANGTTGGTTNTNTGCCCTTTNTGCANGTTTGCCT
rJMFF051B10+ TTTCCTTTTCAATTAATGCATGTTGGTTCTCTGCC
rJMFF042O14+ TTTCCTTTTCAATTAATGCATGTTGGTTCTCTGCCCTTTCTGCATGTTTGCCTCTTCTGT
                      ____________________________________________________________
consensus TTTCCTTTTCAATTAATGCATGTTGGTTCTCTGCCCTTTCTGCATGTTTGCCTCTTCTGT
 
. : . : . : . : . : . :
rJMFF042O14+ TCATTTGTGCGTAGAGATGGCACAAACATTTAATTTATCTAAAAAAAAAAATTATTTTAG
                      ____________________________________________________________
consensus TCATTTGTGCGTAGAGATGGCACAAACATTTAATTTATCTAAAAAAAAAAATTATTTTAG